Infection with

No abstract

A novel DNA assay demonstrating sensitive and accurate detection of Helicobacter pylori from stool samples is reported. Moreover, in three individuals tested for therapeutic response, the assay showed the disappearance of H. pylori DNA during treatment. Thus, this noninvasive molecular biology-based assay has the potential to be a powerful diagnostic tool given its ability to specifically identify H. pylori DNA.Helicobacter pylori infection is recognized as a major causative agent of gastritis and peptic ulcer disease and as a carcinogen responsible for gastric carcinoma and lymphoma (6,8,11). To date, none of the available clinical tests for H. pylori infection has been ideal, with each of the tests observed to have limitations (2). At present, only the PCR assay of gastric biopsy specimens, the retrieval of which is invasive for the patient, has sensitivity and specificity that approaches 100%.Novel, efficient methods of stool specimen processing and specific DNA extraction have recently been developed by the Exact Sciences Corporation (Maynard, Mass.) (1). Herein, we report on the use of this method to optimize detection of H. pylori DNA shed in the stool. The importance of H. pylori DNA detection in diagnostic tests is supported by the capability to genotype infecting strains and to identify virulence factors and markers of resistance to specific antibiotic treatments (3,5,7,9).Stool samples from 25 patients who underwent upper endoscopy were collected and stored frozen for molecular biology-based analyses. Twenty-two of these stool samples were obtained from patients (patients 1 through 22) for whom tests were being performed to detect H. pylori infection prior to H. pylori treatment (4). Stool samples were collected before and after treatment from three additional patients with histologically documented infection (patients 23 through 25).Four grams of frozen stool from each patient were homogenized in 28 ml of EXACT Buffer A (Exact Sciences Corporation). Following homogenization, each sample was centrifuged twice to remove particulate matter and the supernatant was incubated with DNase-free RNase. The DNA was then precipitated with 300 mM sodium acetate and isopropanol, centrifuged, and resuspended in TE buffer (10 mM Tris, 1 mM EDTA [pH 7.4]).Next, the human APC (adenomatous polyposis coli) and the Helicobacter 16S rRNA genes were captured with oligonucleotide capture probes specific for each target gene (H. pylorispecific probe, biotin-GGGGAGTACGGTCGCAAGATTAA AACTCAAAGGAATA; APC-specific probe, biotin-CAGAT AGCCCTGGACAAACCATGCCACCAAGCAGAAG). The extracted DNA was combined with an equal volume of 6 M guanidinium isothiocyanate and 20 nmol of each sequencespecific biotinylated oligonucleotide capture probe for incubation and subsequent magnetic separation of target DNA complex sequences with paramagnetic polystyrene beads coated with streptavidin (Dynabeads M-280 Streptavidin; Dynal ASA, Oslo, Norway), as described previously (1).H. pylori-and human APC-specific PCR amplifications were performed with prime...

We determined age-specific Helicobacter pylori seropositivity rates of 166 children and 39 mothers in an urban shantytown in northeast Brazil. Seropositivity rates increased from 23.1% at 0 to 11 months of age to only 39.3% by 96 to 131 months of age and were 82.1% at maturity. We observed no correlation between the seropositivity of the mothers and the seropositivity of their children.Accumulating evidence suggests that Helicobacter pylori is acquired in early childhood and infects more people in developing countries than in industrialized countries (1,3,4,11). In impoverished areas of developing countries, the H. pylori seropositivity rate by 20 years of age has been shown to be more than 80%, much greater than the 30% seropositivity rate by 30 years of age in industrialized countries (3,6,18). Furthermore, a study of 141 adults showed no significant change in H. pylori infection rates from 1969 to 1990, suggesting that acquisition of H. pylori in adulthood does not play a large role in the high seropositivity rates seen in developing countries (4).In order to understand the transmission and health impact of H. pylori infection, a focus on early childhood infection is necessary (12). Our report presents new age-specific H. pylori seropositivity rates and suggests that neither mother-to-child nor waterborne transmission of the pathogen can account for whom is infected and when the infection occurs.The subjects in this study live in Gonçalves Dias, a slum of FIG. 1. Age-specific seropositivity rates of subjects living in an impoverished urban area of northeast Brazil increased to 39.3% by age 10, before reaching 82% by maturity. Most subjects in our study did not acquire H. pylori infection very early in childhood. n, number of samples.

No abstract