Accurate, Noninvasive Detection of Helicobacter pylori DNA from Stool Samples: Potential Usefulness for Monitoring Treatment

Abstract

A novel DNA assay demonstrating sensitive and accurate detection of Helicobacter pylori from stool samples is reported. Moreover, in three individuals tested for therapeutic response, the assay showed the disappearance of H. pylori DNA during treatment. Thus, this noninvasive molecular biology-based assay has the potential to be a powerful diagnostic tool given its ability to specifically identify H. pylori DNA.Helicobacter pylori infection is recognized as a major causative agent of gastritis and peptic ulcer disease and as a carcinogen responsible for gastric carcinoma and lymphoma (6,8,11). To date, none of the available clinical tests for H. pylori infection has been ideal, with each of the tests observed to have limitations (2). At present, only the PCR assay of gastric biopsy specimens, the retrieval of which is invasive for the patient, has sensitivity and specificity that approaches 100%.Novel, efficient methods of stool specimen processing and specific DNA extraction have recently been developed by the Exact Sciences Corporation (Maynard, Mass.) (1). Herein, we report on the use of this method to optimize detection of H. pylori DNA shed in the stool. The importance of H. pylori DNA detection in diagnostic tests is supported by the capability to genotype infecting strains and to identify virulence factors and markers of resistance to specific antibiotic treatments (3,5,7,9).Stool samples from 25 patients who underwent upper endoscopy were collected and stored frozen for molecular biology-based analyses. Twenty-two of these stool samples were obtained from patients (patients 1 through 22) for whom tests were being performed to detect H. pylori infection prior to H. pylori treatment (4). Stool samples were collected before and after treatment from three additional patients with histologically documented infection (patients 23 through 25).Four grams of frozen stool from each patient were homogenized in 28 ml of EXACT Buffer A (Exact Sciences Corporation). Following homogenization, each sample was centrifuged twice to remove particulate matter and the supernatant was incubated with DNase-free RNase. The DNA was then precipitated with 300 mM sodium acetate and isopropanol, centrifuged, and resuspended in TE buffer (10 mM Tris, 1 mM EDTA [pH 7.4]).Next, the human APC (adenomatous polyposis coli) and the Helicobacter 16S rRNA genes were captured with oligonucleotide capture probes specific for each target gene (H. pylorispecific probe, biotin-GGGGAGTACGGTCGCAAGATTAA AACTCAAAGGAATA; APC-specific probe, biotin-CAGAT AGCCCTGGACAAACCATGCCACCAAGCAGAAG). The extracted DNA was combined with an equal volume of 6 M guanidinium isothiocyanate and 20 nmol of each sequencespecific biotinylated oligonucleotide capture probe for incubation and subsequent magnetic separation of target DNA complex sequences with paramagnetic polystyrene beads coated with streptavidin (Dynabeads M-280 Streptavidin; Dynal ASA, Oslo, Norway), as described previously (1).H. pylori-and human APC-specific PCR amplifications were performed with prime...

Novel Real-Time PCR Assay for Detection of Helicobacter pylori Infection and Simultaneous Clarithromycin Susceptibility Testing of Stool and Biopsy Specimens

“…In recent years, several attempts have been made to detect H. pylori DNA in stool samples by conventional PCR (1,6,11,12,15,19,20). However, most of these reports have revealed low sensitivity.…”

PCR Detection of Bacteria on Cardiac Valves of Patients with Treated Bacterial Endocarditis

“…These studies suggest that bacterial DNA is cleared from the tissue sites of animals after bacterial death but that the DNAs from different pathogens may have different kinetics at different sites. In human pathology, molecular methods based on DNA detection have been used to monitor the treatment of Whipple's disease (34), Lyme arthritis (33), and infections with Helicobacter pylori (42) and Chlamydia trachomatis (1). Our results show that even though bacterial DNA seems to be cleared over time in patients with IE, DNA detection should not be used for monitoring antibiotic efficacy in patients with ongoing IE.…”

Multiplex Real-Time PCR Assay Using Scorpion Probes and DNA Capture for Genotype-Specific Detection of Giardia lamblia on Fecal Samples

“…Genomic DNA of G. lamblia, Entamoeba histolytica, E. dispar, E. moshkovskii, and Cryptosporidium parvum was obtained by this method using pure trophozoite or oocyst pellets. For sequence-specific DNA capture, fecal samples were processed according to the protocol of Shuber et al (23). Briefly, 200 mg of spiked stool was homogenized in 1.4 ml of EXACT Buffer A (Exact Sciences Corporation, Marlborough, Mass.)…”