Events, manifesting transition from maternal to zygotic period of development are studied for more than 100 years, but underlying mechanisms are not yet clear. We provide a brief historical overview of development of concepts and explain the specific terminology used in the field. We further discuss differences and similarities between the zygotic genome activation and in vitro reprogramming process. Finally, we envision the future research directions within the field, where biochemical methods will play increasingly important role.
Abstract:In Danio rerio (zebrafish), members of the vent gene-family (vox/vega1, vent/vega2) are considered as ventralizing factors. We investigated not only the expression of their mRNAs by in situ hybridization at different stages of embryonic development, but also the spatial distribution of the encoded proteins by whole-mount immunostaining. We showed vox mRNA to be available in embryos since early cleavage and later on. Vent mRNA appeared after zygotic genome activation only. The vox and vent proteins were revealed at stage of eight blastomeres. At blastula and gastrula the vox and vent protein staining areas completely overlapped those of the mRNAs. They were expressed uniformly throughout the embryo except for a small region of clearing on the dorsal side. From the bud stage throughout somitogenesis, the vox and vent proteins staining progressively covered the embryos except for dorsal side: at the bud stage it resembled that of mRNA and at the beginning of somitogenesis it was clearly seen along the axis structures. At the pharyngula period stages the proteins were located in neural crest zone, but their mRNAs appeared to be in the tail tips. Thus during embryogenesis, the spatial distributions of a protein and its mRNA may not always quite coincide. We observed such mismatches in embryos at the cleavage stage and in the pharyngula period. axial structures and around somites. In this study we for the first time compared the patterns of vent-family mRNAs and the encoded proteins in zebrafish embryos at early stages, before and after zygotic genes activation.
Keywords
Methods
Embryo stagesZebrafish embryos developmental stages were identified according to tables (11).
Isolation of RNA and RT-PCR analysisZebrafish embryos at stages 1-4 blastomeres were fixed with MEMFA solution (0.1 M MOPS pH 7.4; 2 mM EGTA; 2 mM MgSO 4 ; formaldehyde 3.7%) for 6 hours at room temperature and 12 hours at 4 ℃. Then they were transferred gradually into 70% ethanol and stored at −20 ℃. RNA isolation was performed as in (12). The rehydrated embryos were washed sequentially with 2 M glycine containing 5 mM EDTA pH 8.0 and the buffer for proteinase K (10 mM Tris pH 8.0, 5 mM EDTA, 50 mM NaCl). To the last wash solution 1 mg of proteinase K and 30 mkg of glycogen were added. After incubation at 42 ℃ for 1 h, the sample was supplemented with 1 ml of the solution containing 40 mM Tris pH 7.5, 4% SDS, 0.4 M NaCl, and 10 mM EDTA and incubated for an additional 30 min at 42 ℃ and 30 min at 80 ℃. Then the sample was transferred into a tube, and a standard phenol-chloroform deproteinization was carried on (13). After DNAse treatment the standard phenolchloroform deproteinization was performed again and the isolated RNA was used in the reverse transcription reaction with the primer 5' TTCAGTAGTAATGATGTCTGGGCG 3'. The PCR was performed with this primer and the second primer 5' GAAATCATGGTGAAGAACTTTTCC 3'. The cDNA product was supposed to correspond to a full-length coding region of vox mRNA-736bp. The product of RT-PCR was analyzed by elec...
The distribution of Xwnt-11 mRNA between polysomes and informosomes was studied in Xenopus laevis and Rana temporaria during early embryogenesis. The ratio between polysomes and informosomes suggests their involvement in translation of these mRNAs. In eggs and immediately after fertilization the Xwnt-11 mRNAs are mostly positioned in informosomes. During the cleavage stage, these mRNAs have also been recognized in polysomes. Just before the onset of zygote genome functioning (at the stage of mid blastula), Xwnt-11 mRNA rapidly appears in polysomes of Rana embryos. However, in Xenopus, Xwnt-11 mRNA appears in polysomes only at the end of gastrula. Before this stage, the Xwnt-11 mRNA in Xenopus can be found mostly in informosomes.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.