Xbra and Smad-1 cooperate to activate the transcription of neural repressor ventx1.1 in Xenopus embryos

Abstract

Crosstalk of signaling pathways play crucial roles in cell proliferation, cell differentiation, and cell fate determination for development. In the case of ventx1.1 in Xenopus embryos, both BMP-4/Smad-1 and FGF/Xbra signaling induce the expression of neural repressor ventx1.1. However, the details of how these two pathways interact and lead to neural inhibition by ventx1.1 remain largely unknown. In the present study, Xbra directly bound to the ventx1.1 promoter region and inhibited neurogenesis in a Ventx1.1-dependent manner. Furthermore, Smad-1 and Xbra physically interacted and regulated ventx1.1 transcription in a synergistic fashion. Xbra and Smad-1 interaction cooperatively enhanced the binding of an interacting partner within the ventx1.1 promoter and maximum cooperation was achieved in presence of intact DNA binding sites for both Smad-1 and Xbra. Collectively, BMP-4/Smad-1 and FGF/Xbra signal crosstalk cooperate to activate the transcription of neural repressor ventx1.1 in Xenopus embryos. This suggests that the crosstalk between BMP-4 and FGF signaling negatively regulates early neurogenesis by synergistic activation of ventx1.1 in Xenopus embryos.

Foxd4l1.1 negatively regulates transcription of neural repressor ventx1.1 during neuroectoderm formation in Xenopus embryos

“…We have previously shown that foxd4l1.1 inhibits the promoter activity of ventx1.1 and promotes primary neurogenesis in Xenopus embryos 15 . A study documented that foxd4l1.1 and its engrailed (repressor) conjugated construct (EnRfoxd4l1.1) induce the expression of neural markers such as xngnr1, n-tubulin, geminin and xnr3 in animal cap explants 37 .…”

“…BMP4/Smad1 is known to interact with FGF/Xbra to induce the expression of an endogenous neural repressor transcription factor (TF) Ventx1.1 15,16 . Ventx1.1 is a homeobox transcription repressor which inhibits the expression of organizer-specific and neural genes, including gsc, chordin, noggin, ncam, ngnr, zic3 and foxd4l1.1 17,18 .…”

“…FGF/MAPK activation was shown to inhibit BMP4/Smad1 signaling and promote neuroectoderm formation by phosphorylating the linker region of Smad1, resulting in the cytoplasmic retention of Smad1 [21][22][23][24] . On the other hand, signaling by both BMP4/Smad1 and FGF/Xbra had a synergistic role in activating ventx1.1 transcription to inhibit neuroectoderm formation 15,16 . The details of inhibitory gene regulatory network and transcriptional mechanism of the neural repressor gene ventx1.1 in neuroectoderm region await elucidation.…”

“…In the present study, we focused on the mechanisms of reciprocally exclusive germ-layer (ectoderm, mesoderm and neuroectoderm) specification in early vertebrate embryogenesis. In the mesoderm region, both BMP/ Smad1 and FGF/Xbra synergistically upregulate transcription of neural repressor ventx1.1 and inhibit neuroectoderm formation in Xenopus embryos 15,18 . On the other hand, the neuroectoderm region may require a neuroectoderm specific repressor in order to inhibit ventx1.1 expression.…”

Intracellular enhancement of BMP signaling by LIM-domain protein FHL3 controls spatiotemporal emergence of the neural crest driven by WNT signaling

“…Forward TGGAAGAGGGCCCTTACTGT Reverse TGCTCGTGGTAATGACGGTT This article ODC Forward GCCCTTTCTCCCTTTAACGC Reverse TGGTCCCAAGGCTAAAGTTG (Milet et al, 2013) pRL-CMV (Renilla) Promega E2261 Xenopus laevis cDNA Smad1-FLAG (Kumar et al, 2018) N/A Xenopus laevis cDNA pBS-KS-snai2 (Grammer et al, 2000) N/A Xenopus laevis cDNA pCS107-sox2 (Mizuseki et al, 1998) N/A Xenopus laevis cDNA pBS-KS-sox10 (Aoki et al, 2003) N/A Xenopus laevis cDNA Inducible TCF-VP16-GR (Molenaar et al, 1996) N/A Xenopus laevis cDNA pCS108-Tfap2 alpha (De Crozé et al, 2011) N/A TOPFLASH reporter (WNT reporter) Gift from R. Harland N/A Xenopus laevis cDNA pBS-KS-Twist1 (Hopwood et al, 1989b) N/A Xenopus laevis cDNA pGEM-Wnt8 (Christian et al, 1991) N/A Xenopus laevis cDNA pGEM7-Tbxt (Xbra) (Smith et al, 1991) N/A Xenopus laevis cDNA pCS2-zic1 (Mizuseki et al, 1998) N/A Xenopus laevis cDNA pCS2+-Zic1GR (Hong and Saint-Jeannet, 2007) N/A Software and Algorithms PRISM Graphpad N/A Photoshop Adobe ImageJ…”