West Nile virus surveillance, Brazil, 2008–2010

Ometto, Tatiana; Durigon, Edison Luíz; Araújo, Jansen de; Aprelon, Rosalie; Aguiar, Daniel Moura de; Cavalcante, Guacyara Tenório; Melo, Rosane Marini; Levi, José Eduardo; Júnior, Severino Mendes de Azevedo; Petry, Maria Virgı́nia; Neto, Isaac Simão; Serafini, Patrícia Pereira; Villalobos, Eliana Monteforte Cassaro; Cunha, Elenice Maria Sequetin; Lara, Maria do Carmo Custódio de Souza Hunold; Nava, Alessandra; Nardi, Marcello Schiavo; Hurtado, Renata; Rodrigues, Roberta Costa; Sherer, Angelo Luís; Sherer, Janete de Fátima Martins; Geraldi, Marcelo Plaisant; Seixas, Marina Maria Moraes de; Peterka, Cassio Roberto Leonel; Bandeira, Debora de Souza; Pradel, Jennifer; Vachiéry, Nathalie; Labruna, Marcelo Bahia; Camargo, Luís Marcelo Aranha; Lanciotti, Robert S.; Lefrançois, Thierry

doi:10.1093/trstmh/trt081

Cited by 56 publications

(54 citation statements)

References 25 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Resident birds tested positive for antibodies to WNV in the Dominican Republic and Venezuela [105]. Recently, WNV antibodies were identified in several horses and birds in Brazil [107]. Although extensive, the spread has not been accompanied by notable avian mortality or disease in humans or horses in Latin America and the Caribbean [71], although the main concern is the absence of data on the disease burden in people, horses or birds [108].…”

Section: South Americamentioning

confidence: 99%

Climate change impacts on West Nile virus transmission in a global context

Paz

2015

Phil. Trans. R. Soc. B

208

140

View full text Add to dashboard Cite

West Nile virus (WNV), the most widely distributed virus of the encephalitic flaviviruses, is a vector-borne pathogen of global importance. The transmission cycle exists in rural and urban areas where the virus infects birds, humans, horses and other mammals. Multiple factors impact the transmission and distribution of WNV, related to the dynamics and interactions between pathogen, vector, vertebrate hosts and environment. Hence, among other drivers, weather conditions have direct and indirect influences on vector competence (the ability to acquire, maintain and transmit the virus), on the vector population dynamic and on the virus replication rate within the mosquito, which are mostly weather dependent. The importance of climatic factors (temperature, precipitation, relative humidity and winds) as drivers in WNV epidemiology is increasing under conditions of climate change. Indeed, recent changes in climatic conditions, particularly increased ambient temperature and fluctuations in rainfall amounts, contributed to the maintenance (endemization process) of WNV in various locations in southern Europe, western Asia, the eastern Mediterranean, the Canadian Prairies, parts of the USA and Australia. As predictions show that the current trends are expected to continue, for better preparedness, any assessment of future transmission of WNV should take into consideration the impacts of climate change.

show abstract

Section: South Americamentioning

confidence: 99%

Climate change impacts on West Nile virus transmission in a global context

Paz

2015

Phil. Trans. R. Soc. B

208

140

View full text Add to dashboard Cite

show abstract

“…On the other hand, crocodilians captured in the Pantanal, coexisting with several species of water birds, tested negative for WNV (Pauvolid-Corrêa et al, 2011), which is consistent with the findings of this study. Ometto et al (2013), who also evaluated birds in the same region, did not detect any positivity for WNV. Negative results in birds and crocodilians, coupled with the serological detection of antibodies in horses, reinforces the need for further studies and intensive surveillance of WNV in the Pantanal region.…”

Section: Discussionmentioning

confidence: 85%

“…The genetic material in each pool was extracted using a semi-automated MagMAX™ Express-96 Pathogen RNA/DNA kit (5X) (Ambion, Inc., Austin, TX, USA), according to the protocol described by Ometto et al (2013). The RNA sample extracted from each pool was analyzed by One-…”

Section: Methodsmentioning

confidence: 99%

“…For the detection of WNV, specific primers for Gene E, SEQ1F (GCGATCTCTCCACCAAAGCT) and SEQ1R (TGGGTCAGCACGTTTGTCAT) were applied with the SEQ1M1 [FAM]-CCATGGGAGAAGCTCACA [NFQ] probe (Ometto et al, 2013). Lastly, to detect both classes of NDV, a specific class I NDV pair of primers, forward for the matrix gene M+4100F (AGTGATGTGCTCGGACCTTC) and reverse for M-4220R (CCTGAGGAGAGGCATTTGCTA), covering 120 pb, were applied with an M4169 [FAM] TTCTCTAGCAGTGGGACAGCCTGC [MGB] probe (Wise et al, 2004); and class II NDV with same cycling conditions, allowing a multiplex format, whereupon the polymerase gene L+8738 sense primer (TGTTGAAAAGAAGCTGCTAGGC) and reverse L-8847 (TGGACCATGAAGAGTGGAACC), were applied with an L8762 [TET] TGCCTGGTCACACAAGATCCGCCG [MGB] probe (Kim et al, 2008).…”

Section: Methodsmentioning

confidence: 99%

“…The ecological conditions of South and Central America, i.e., climate, vegetation and fauna, favor the introduction and maintenance of this virus in this region (Morales et al, 2006). Anti-WNV antibodies in horses have also been reported in the Pantanal region of Mato Grosso and its surroundings (Ometto et al, 2013, Pauvolid-Corrêa et al, 2011. In addition, the Brazilian Ministry of Health of Brazil recently reported a case of West Nile Virus (WNV) in the State of Piauí.…”

Section: Introductionmentioning

confidence: 97%

See 2 more Smart Citations

Investigation of Influenza A, West Nile and Newcastle Disease Viruses in Birds from the Pantanal Wetlands of Mato Grosso, Brazil

Pinto

Ometto

Araújo

et al. 2016

Rev. Bras. Cienc. Avic.

View full text Add to dashboard Cite

The Pantanal is the world's largest wetland biome with a seasonal flood pulse that attracts a great diversity of birds, many of which are migratory. Birds can be natural reservoirs Influenza A, West Nile and Newcastle Disease viruses. However, the occurrence of carriers for these viruses in the Pantanal was not verified yet. The present study evaluated the occurrence of natural infection by Influenza A, WN and ND virus of birds in the municipality of Poconé, a subregion of the Pantanal in the state of Mato Grosso, Brazil. A total of 76 birds belonging to 11 orders and 20 families were captured using mist nets. The most representative order was Passeriformes, followed by the other nine orders, which included Columbiformes, Psittaciformes, Charadriiformes and Anseriformes. The most representative family was Thamnophilidae, with 16 individuals (21.0%), followed by the family Tyrannidae with 10 individuals (7.6%) and the family Furnariidae, with eight individuals (10.5%). The bird species were identified, and cloacal and tracheal swab samples were collected. The samples were subjected to RNA extraction and tested for the presence of the three agents by real-time polymerase chain reaction (qRT-PCR). All the sampled birds were considered healthy, had no clinical sign of infection, and were tested negative for the three viruses. Based on our findings, we can conclude that Influenza, West Nile and Newcastle Disease viruses were absent from the samples in this region of the Pantanal wetlands during the period of this study.

show abstract

Co-circulation in a single biome of the Juquitiba and Araraquara hantavirus detected in human sera in a sub-tropical region of Brazil

et al. 2015

Self Cite

View full text Add to dashboard Cite

Hantaviruses is an emerging infectious disease. Although HCPS has been reported in several regions of Brazil, more cases of HCPS have recently been reported in Minas Gerais than in any other state. In 2009, we analyzed 27 samples presenting antibodies against hantaviruses. These samples originated from 688 symptomatic patients, as determined based on the Hemorrhagic Fever Protocol. A subsequent SYBR Green-based real-time RT-PCR demonstrated the presence of the virus in 22 of the samples. Among the RT-PCR-positive samples, 17 were analyzed using DNA sequencing; these sequences were compared with others deposited in GenBank and showed similarity with the Araraquara and Juquitiba virus clusters. This work describe the detection of Juquitiba virus, including three fatal cases, in Minas Gerais state, furthermore, showed that it is feasible to characterize the circulating strains using a small fragment of S segment. Finally, the results suggest the co-circulation of Araraquara and Juquitiba virus in a single biome in Minas Gerais state.

show abstract

West Nile virus surveillance, Brazil, 2008–2010

Abstract: WNV circulation is confirmed by this large scale survey even in the absence of detection of clinical cases.

Cited by 56 publications

References 25 publications

Climate change impacts on West Nile virus transmission in a global context

Climate change impacts on West Nile virus transmission in a global context

Investigation of Influenza A, West Nile and Newcastle Disease Viruses in Birds from the Pantanal Wetlands of Mato Grosso, Brazil

Co-circulation in a single biome of the Juquitiba and Araraquara hantavirus detected in human sera in a sub-tropical region of Brazil

Contact Info

Product

Resources

About