Weak population genetic differentiation in the most numerous Arctic seabird, the little auk

Wojczulanis‐Jakubas, Katarzyna; Kilikowska, Adrianna; Harding, Ann M. A.; Jakubas, Dariusz; Karnovsky, Nina J.; Steen, Harald B.; Strøm, Hallvard; Welcker, Jörg; Gavrilo, Maria; Lifjeld, Jan T.; Johnsen, Arild

doi:10.1007/s00300-014-1462-5

Cited by 30 publications

(33 citation statements)

References 58 publications

(61 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Our study suggests that this may impair the survival and, hence, decrease the population size of little auks – whose apparently strong breeding site fidelity (Norderhaug 1968; Wojczulanis-Jakubas et al. 2014) likely prevents them to relocate their breeding site when foraging conditions deteriorate. However, also other factors, such as the recruitment of new breeders to a population and natal philopatry (recruitment to natal colony), can strongly affect the seabird population dynamics (e.g., Suryan and Irons 2001; Sandvik et al.…”

Section: Discussionmentioning

confidence: 99%

Climate warming decreases the survival of the little auk (Alle alle), a highArctic avian predator

Hovinen

Welcker

Descamps

et al. 2014

Ecology and Evolution

Self Cite

View full text Add to dashboard Cite

Delayed maturity, low fecundity, and high adult survival are traits typical for species with a long-life expectancy. For such species, even a small change in adult survival can strongly affect the population dynamics and viability. We examined the effects of both regional and local climatic variability on adult survival of the little auk, a long-lived and numerous Arctic seabird species. We conducted a mark-resighting study for a period of 8 years (2006-2013) simultaneously at three little auk breeding sites that are influenced by the West Spitsbergen Current, which is the main carrier of warm, Atlantic water into the Arctic. We found that the survival of adult little auks was negatively correlated with both the North Atlantic Oscillation (NAO) index and local summer sea surface temperature (SST), with a time lag of 2 and 1 year, respectively. The effects of NAO and SST were likely mediated through a change in food quality and/or availability: (1) reproduction, growth, and development of Arctic Calanus copepods, the main prey of little auks, are negatively influenced by a reduction in sea ice, reduced ice algal production, and an earlier but shorter lasting spring bloom, all of which result from an increased NAO; (2) a high sea surface temperature shortens the reproductive period of Arctic Calanus, decreasing the number of eggs produced. A synchronous variation in survival rates at the different colonies indicates that climatic forcing was similar throughout the study area. Our findings suggest that a predicted warmer climate in the Arctic will negatively affect the population dynamics of the little auk, a high Arctic avian predator.

show abstract

Section: Discussionmentioning

confidence: 99%

Climate warming decreases the survival of the little auk (Alle alle), a highArctic avian predator

Hovinen

Welcker

Descamps

et al. 2014

Ecology and Evolution

Self Cite

View full text Add to dashboard Cite

show abstract

“…This is consistent with a previous investigation of population genetics of the nominate subspecies (Wojczulanis‐Jakubas et al . ).…”

Section: Discussionmentioning

confidence: 97%

“…This exchange of individuals is likely to result from natal dispersal (movement between the natal and recruitment site), as adults appear to be faithful to their breeding locations (Wojczulanis‐Jakubas et al . ). There is no information on philopatry or the extent and direction of natal dispersal in the Little Auk, but in other alcids some young may breed away from their natal colony (e.g.…”

Section: Discussionmentioning

confidence: 97%

“…For the control region of mtDNA, we designed primers (AlleMCR‐H50: 5′‐ATGTGGGTGTGtACATTAAAC and AlleMCR‐L750: 5′‐TTATGCCCAACAAGCATTCAC) based on previously published Little Auk control region sequences and primers (Wojczulanis‐Jakubas et al . ). We added a universal M13 tail (M13F: 5′‐GTAAAACGACGGCCAGT) to the heavy strand primer for automated sequencing.…”

Section: Methodsmentioning

confidence: 97%

“…Wojczulanis‐Jakubas et al . () found no differences in mitochondrial DNA (mtDNA) between them, but tested only three individuals of A. a. polaris . In the present study, we used two types of neutral molecular markers (mtDNA and microsatellite loci) to investigate genetic variation within a larger sample of individuals representing the two Little Auk subspecies.…”

mentioning

confidence: 99%

See 2 more Smart Citations

No evidence of divergence at neutral genetic markers between the two morphologically different subspecies of the most numerous Arctic seabird

Wojczulanis‐Jakubas

Kilikowska

Fort

et al. 2015

Ibis

Self Cite

View full text Add to dashboard Cite

Identifying natural populations that might be considered separate units using morphology, genotype or both is important in understanding the process of speciation and for conservation. We examined the relationships between the only two subspecies of the most numerous Arctic seabird, the Little Auk Alle alle, using both morphological (wing and head-bill lengths) and genetic data (482 base pairs of the mitochondrial control region and seven nuclear microsatellite loci). We found significant morphological differences between the subspecies, A. a. polaris being significantly larger than the nominate A. a. alle. However, we did not find the subspecies to be differentiated at either mitochondrial DNA or at microsatellite loci. Consequently, one evolutionary significant unit is proposed. The similarity of the two subspecies at neutral genetic markers may be due to contemporary gene flow between populations, as well as large population sizes both in the present and in the past, combined with recent post-glacial colonization of the Artic.

show abstract

Historical fragmentation and stepping‐stone gene flow led to population genetic differentiation in a coastal seabird

Harkness,

Ibarguchi,

Poland

et al. 2024

Ecology and Evolution

View full text Add to dashboard Cite

Understanding the forces that shape population genetic structure is fundamental both for understanding evolutionary trajectories and for conservation. Many factors can influence the geographic distribution of genetic variation, and the extent to which local populations differ can be especially difficult to predict in highly mobile organisms. For example, many species of seabirds are essentially panmictic, but some show strong structure. Pigeon Guillemots (Cepphus columba; Charadriiformes: Alcidae) breed in small colonies scattered along the North Pacific coastline and feed in shallow nearshore waters year‐round. Given their distribution, gene flow is potentially lower and population genetic structure is stronger than in most other high‐latitude Northern Hemisphere seabirds. We screened variation in the mitochondrial control region, four microsatellite loci, and two nuclear introns in 202 Pigeon Guillemots representing three of five subspecies. Mitochondrial sequences and nuclear loci both showed significant population differences, although structure was weaker for the nuclear loci. Genetic differentiation was correlated with geographic distance between sampling locations for both the mitochondrial and nuclear loci. Mitochondrial gene trees and demographic modeling both provided strong evidence for two refugial populations during the Pleistocene glaciations: one in the Aleutian Islands and one farther east and south. We conclude that historical fragmentation combined with a stepping‐stone model of gene flow led to the relatively strong population differentiation in Pigeon Guillemots compared to other high‐latitude Northern Hemisphere seabird species. Our study adds to growing evidence that Pleistocene glaciation events affected population genetic structure not only in terrestrial species but also in coastal marine animals.

show abstract

Weak population genetic differentiation in the most numerous Arctic seabird, the little auk

Cited by 30 publications

References 58 publications

Climate warming decreases the survival of the little auk (Alle alle), a highArctic avian predator

Climate warming decreases the survival of the little auk (Alle alle), a highArctic avian predator

No evidence of divergence at neutral genetic markers between the two morphologically different subspecies of the most numerous Arctic seabird

Historical fragmentation and stepping‐stone gene flow led to population genetic differentiation in a coastal seabird

Contact Info

Product

Resources

About