von Willebrand factor cleaving protease (ADAMTS‐13) and ADAMTS‐13 neutralizing autoantibodies in 100 patients with thrombotic thrombocytopenic purpura

Abstract

SummaryThe congenital or acquired deficiency of the von Willebrand factor (VWF) cleaving protease, ADAMTS-13 has been specifically associated with a diagnosis of thrombotic thrombocytopenic purpura (TTP), a microangiopathy characterized by the formation of occlusive platelet thrombi. The mechanisms of TTP were investigated in 100 patients diagnosed on the basis of the presence of at least three of the following: thrombocytopenia, haemolytic anaemia, elevated serum levels of lactate dehydrogenase and neurological symptoms. Plasma levels of ADAMTS-13 were severely reduced (<10% of normal) in 48%, moderately reduced (between 10% and 46%) in 24% and normal (>46%) in 28%. A neutralizing antibody was the cause of the deficiency in 38% of the cases, with a higher prevalence of this mechanism (87%) in the 48 patients with severely reduced ADAMTS-13. Double heterozygosity for a 29 base pair (bp) deletion and a nucleotide insertion and homozygosity for a 6 bp deletion in the ADAMTS13 gene were identified only in two patients born from consanguineous marriages. In conclusion, this study indicated that ADAMTS-13 was normal in nearly one-third of patients with TTP and that ADAMTS-13 deficiency was not associated with the presence of neutralizing antibodies in more than half of the patients.

Nonsense-mediated mRNA decay in the ADAMTS13 gene caused by a 29-nucleotide deletion

“…20,21 With regards to the 29bp deletion mutation, we evaluated whether a regulatory mechanism, known as nonsensemediated mRNA decay, could have any role in the level of expression of ADAMTS13 mRNA.…”

“…The first mutation was a deletion of 29 nucleotides located at exon 3 (c.291_319delGGAGGA CACAGAGCGCTATGTGCTCACCA) causing a frameshift with premature termination codons in the metalloprotease domain. 21 The second mutation was an insertion of an adenine (A) at 4143_4144 codon in the second CUB domain, which introduced a premature termination at codon 1381 causing the loss of the last 49 amino acids at the C-terminus of ADAMTS13.…”

“…20 The other mutation, located on the paternal allele, is a 29-nucleotide deletion mutation located in exon 3 at codon 291 (c.291_319delGGAGGACACAGA GCGCTATGTGCTCACCA) which causes premature termination codons. 21 The main goal of this study was to demonstrate how the premature termination codon introduced by the 29 bp deletion leads to a reduction of ADAMTS13 mRNA levels through such regulatory mechanisms as nonsense-mRNA decay.…”

ADAMTS13 gene variants and function in women with preeclampsia: A population- based nested case- control study from the HUNT Study

“…Most of the reported mutations are limited to individual families, with two exceptions: 1) Mutation c.4143_4144dupA, where the insertion of a single base (adenine, A) at position 4143_4144 results in a frameshift and loss of 49 amino acids is one of the most frequently reported ADAMTS13 mutations in Caucasians [17][18][19][20][21][22][23] and therefore included in this study. 2) Mutation c.3178C>T (p.Arg1060Trp) in exon 24 is also frequent and associated with late-onset and pregnancy related TTP, and is therefore of special interest in relation to preeclampsia [24,25].…”

Púrpura trombocitopênica trombótica: o papel do fator von Willebrand e da ADAMTS13

“…Peyvandi et al 35 e Zheng et al 36 relataram deficiência grave da atividade da enzima em apenas 48 dos 100 pacientes avaliados. Paradoxalmente, uma deficiência da atividade da ADAMTS13 tem sido relatada em outros casos de microangiopatias trombóticas distintos da PTT.…”