Vectors for efficient and high‐throughput construction of fluorescent <i>drosophila</i> reporters using the <i>PhiC31</i> site‐specific integration system

Boy, Aurelia L.; Zhai, Zongzhao; Habring-Müller, Anette; Kußler‐Schneider, Yvonne; Kaspar, Petra; Lohmann, Ingrid

doi:10.1002/dvg.20637

Cited by 30 publications

(26 citation statements)

References 25 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In most cases, the GAL4 gene was flanked by both 5′ and 3′ regions of the IR genes in an effort to maximize fidelity of the reporter. Most transgenes were integrated at common positions using the phiC31 system to minimize genomic position effects (18)(19)(20)(21)(22). Expression was assessed using a membrane-bound GFP encoded by UAS-mCD8-GFP (23).…”

Section: Resultsmentioning

confidence: 99%

Candidate ionotropic taste receptors in the Drosophila larva

Stewart

Koh

Ghosh

et al. 2015

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

We examine in Drosophila a group of ∼35 ionotropic receptors (IRs), the IR20a clade, about which remarkably little is known. Of 28 genes analyzed, GAL4 drivers representing 11 showed expression in the larva. Eight drivers labeled neurons of the pharynx, a taste organ, and three labeled neurons of the body wall that may be chemosensory. Expression was not observed in neurons of one taste organ, the terminal organ, although these neurons express many drivers of the Gr (Gustatory receptor) family. For most drivers of the IR20a clade, we observed expression in a single pair of cells in the animal, with limited coexpression, and only a fraction of pharyngeal neurons are labeled. The organization of IR20a clade expression thus appears different from the organization of the Gr family or the Odor receptor (Or) family in the larva. A remarkable feature of the larval pharynx is that some of its organs are incorporated into the adult pharynx, and several drivers of this clade are expressed in the pharynx of both larvae and adults. Different IR drivers show different developmental dynamics across the larval stages, either increasing or decreasing. Among neurons expressing drivers in the pharynx, two projection patterns can be distinguished in the CNS. Neurons exhibiting these two kinds of projection patterns may activate different circuits, possibly signaling the presence of cues with different valence. Taken together, the simplest interpretation of our results is that the IR20a clade encodes a class of larval taste receptors.taste | ionotropic receptors | taste receptors | larva

show abstract

Section: Resultsmentioning

confidence: 99%

Candidate ionotropic taste receptors in the Drosophila larva

Stewart

Koh

Ghosh

et al. 2015

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

show abstract

“…The Enh1-GFP reporter was generated by Gateway cloning (Invitrogen). Genomic sequences 3L:18,351,841to18,356,841 (PCR'd from CH322-130A20 56 ) were inserted into a GFP-destination vector 57 (primers: Enh1-attb1-F, GGGGACAAGTTTGTACAAAA AAGCAGGCTGTAGGCAAATAGTAATGAAAG, Enh1-attb2-R,GGGGACCACTTTGT ACAAGAAAGCTGGGTGTCTGCTTTCCAAATTCC). Transgenic flies were generated by Genetic Services (Cambridge, MA, USA).…”

Section: Discussionmentioning

confidence: 99%

Neural stem cell progeny regulate stem cell death in a Notch and Hox dependent manner

et al. 2015

View full text Add to dashboard Cite

“…Ci site rankings are determined by sorting all possible 9-mers in order of matrix similarity score, such that the optimal motif (GACCACCCA), with a score of 100, has a rank of 1; were subcloned into the pENTR/D-TOPO plasmid (Invitrogen) by TOPO cloning. Enhancers were subsequently cloned into the pHPdesteGFP transgenesis vector [60] by LR Cloning (Invitrogen), or into the pEAB transgenesis vector (N. C. Evans & S. Barolo 2012, unpublished data) by traditional cloning methods. Targeted binding site mutations were created by overlap extension PCR [61].…”

Section: Hhmentioning

confidence: 99%

Low-affinity transcription factor binding sites shape morphogen responses and enhancer evolution

Ramos

Barolo

2013

Phil. Trans. R. Soc. B

105

113

View full text Add to dashboard Cite

In the era of functional genomics, the role of transcription factor (TF)–DNA binding affinity is of increasing interest: for example, it has recently been proposed that low-affinity genomic binding events, though frequent, are functionally irrelevant. Here, we investigate the role of binding site affinity in the transcriptional interpretation of Hedgehog (Hh) morphogen gradients . We noted that enhancers of several Hh-responsive Drosophila genes have low predicted affinity for Ci, the Gli family TF that transduces Hh signalling in the fly. Contrary to our initial hypothesis, improving the affinity of Ci/Gli sites in enhancers of dpp , wingless and stripe , by transplanting optimal sites from the patched gene, did not result in ectopic responses to Hh signalling. Instead, we found that these enhancers require low-affinity binding sites for normal activation in regions of relatively low signalling. When Ci/Gli sites in these enhancers were altered to improve their binding affinity, we observed patterning defects in the transcriptional response that are consistent with a switch from Ci-mediated activation to Ci-mediated repression. Synthetic transgenic reporters containing isolated Ci/Gli sites confirmed this finding in imaginal discs. We propose that the requirement for gene activation by Ci in the regions of low-to-moderate Hh signalling results in evolutionary pressure favouring weak binding sites in enhancers of certain Hh target genes.

show abstract

Vectors for efficient and high‐throughput construction of fluorescent drosophila reporters using the PhiC31 site‐specific integration system

Cited by 30 publications

References 25 publications

Candidate ionotropic taste receptors in the Drosophila larva

Candidate ionotropic taste receptors in the Drosophila larva

Neural stem cell progeny regulate stem cell death in a Notch and Hox dependent manner

Low-affinity transcription factor binding sites shape morphogen responses and enhancer evolution

Contact Info

Product

Resources

About