Using CRISPR/Cas9 System to Knock out Exon 48 in DMD Gene

Abstract

Background: Out of frame mutations in DMD gene cause Duchenne Muscular Dystrophy (DMD) which is a neuromuscular progressive genetic disorder. In DMD patients, lack of dystrophin causes progressive muscle degeneration, which results in heart and respiratory failure leading to premature death. At present, there is no certain treatment for DMD. DMD gene is the largest gene in human genome by 2.2 mega base pairs and contains 79 exons. In the past few years, gene therapy has been considered a promising DMD treatment, and among various gene-editing technologies, CRISPR/Cas9 system is shown to be more precise and reliable. The aim of this study was to assess the possibility of knocking out exon 48 by using a pair of sgRNAs.
 Methods: A pair of guide RNAs (gRNAs) was designed to cleave DMD gene and induce deletion of exon 48. gRNAs were transfected to the HEK-293 cell line and then the deletion in genomic DNA was analyzed by PCR and subsequent Sanger sequencing.
 Results: Exon 48 was successfully deleted and therefore exon 47 was joined to exon 49.
 Conclusion: This result indicated that CRISPR/Cas9 system could be used to edit DMD gene precisely.

Insight into prognostics, diagnostics, and management strategies for SARS CoV-2

“…Therefore, CRISPR/Cas has enticed much importance in the scientific community for disease diagnosis and management owing to its robust, less expensive, and precise genome editing approaches. 131 CRISP works similar to genomic programming by manipulating isothermal reactions to synthesize and amplify cDNA that again reconvert to RNA. The CRISP editor is programmed to bind to amplified RNA with specified genetic coding to edit at a precise location, thereby cutting off the quencher from fluorescence for signal detection for genotyping, POC virus analysis, and disease monitoring.…”

Novel insight into FCSK‐congenital disorder of glycosylation through a CRISPR‐generated cell model

“…The used primers were as follows: Forward, 5’‐TTCTTGGGTAGTTTGCAGTTTTAA‐3′ and Reverse, 5′‐CACGCGCTAAAAACGGACTA‐3′ (Dara et al., 2021 ).…”

CRISPR-Cas9 Gene Therapy for Duchenne Muscular Dystrophy

“…Many studies have demonstrated that pairs of specific sgR-NAs may be used to induce cuts in introns, thus restoring the normal reading frame for DMD genes with a deletion or a duplication of one or several exons [39][40][41] (Fig. 3A, C).…”