Upsurge and spread of G3 rotaviruses in Eastern India (2014–2016): Full genome analyses reveals heterogeneity within Wa-like genomic constellation

Banerjee, Anindita; Lo, Mahadeb; Indwar, Pallavi; Das, Santasabuj; Manna, Byomkesh; Bhadra, Uchhal K.; Bhattacharya, Maitreyee; Okamoto, Keinosuke; Chawla‐Sarkar, Mamta

doi:10.1016/j.meegid.2018.05.026

Cited by 14 publications

(12 citation statements)

References 48 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The results of the RT-PCR also showed a similar trend as that of PAGE. Earlier studies also reported 38–40% rotavirus positivity during 2012–2016 ( Girish Kumar et al., 2016 ; Banerjee et al., 2018 ). It was also observed that 96% of long and 84.61% short electropherotype profile samples were found to be positive by RT-PCR by rota1-rota2 primers.…”

Section: Resultsmentioning

confidence: 83%

“…Limited studies on rotaviral genotypes in Eastern India revealed G1 (57%) as the most predominant type followed by mixed types (20%), G2 (13%) and G4 (9%) (NICED, Annual Report, 2002–03), while, G1P[8] genotype was frequently isolated from Western India ( Chitamber et al., 2012 ; Jain et al., 2016 ; Maher et al., 2016 ). However, shift in dominating strains from the G1P[8] to G3P[8] was observed in 2016 from Eastern part of India ( Banerjee et al., 2018 ). National Rotavirus surveillance in India also showed that the G1P[8] strain was the one among the two most common strains from December 2005 to November 2007 ( Kang et al., 2009 ).…”

Section: Resultsmentioning

confidence: 99%

“…A number of studies carried out in different parts of India revealed varied prevalence rates of rotavirus from 5 to 71% in hospitalized children less than 5 yr of age with acute gastroenteritis (Jain et al, 2001a;Broor et al, 2003;Kelkar et al, 1999). Previously reported region-wise prevalence of rotaviral diarrhoea varied from 6-45% in North India (Broor et al, 1993;Jain et al, 2001a); 16-22% from South India (Bhat et al, 1985;Brown et al, 1988); 38-41% from East India (Jain et al, 2001b;Banerjee et al, 2018) and 28-30% in West India (Kelkar et al, 1999;Jain et al, 2001b).…”

Section: Detection Of Rotavirus By Rna-page and Rt-pcrmentioning

confidence: 98%

See 2 more Smart Citations

Genotypic determination of human group A rotaviruses from Goa and Meghalaya states, India

Raorane

Dubal

Ghatak

et al. 2020

Heliyon

View full text Add to dashboard Cite

Introduction Rotavirus is the leading cause of diarrhoea in young children in India, responsible for an estimated 21357 mean numbers of deaths in 2010. Various genotypes of rotaviruses evolved due to mutational changes have been recognized. In this study, we determined the genotypes of rotaviruses involved in diarrhea in Goa and Meghalaya states of India. Methods The dsRNA of rotaviruses was extracted from stool samples and detected by Ribonucleic Acid-Polyacrylamide gel electrophoresis (RNA PAGE) and Reverse transcription-polymerase Chain Reaction (RT-PCR) targeting the partial VP7 gene. The full length VP7 and partial VP4 genes of rotavirus strains were amplified by RT-PCR followed by nucleotide sequencing. The RotaC classification tool was used to determine the genotypes. Results The positivity of rotavirus by PAGE and RT-PCR was observed to be 43.10% and 39.65% in Goa and 38% and 36% in Meghalaya, respectively. Though long electrophoretic profile was appeared to be the most predominant rotavirus type in circulation in these two states, 96% of long and 84.61% short electropherotype profiles could be detected by RT-PCR. The dsRNA of rotavirus extracted from 36 samples could be transcribed and amplified by beg9end9 primers for G genotyping, while, 41 by con3con2 primers for P genotyping. G1P[8] and G1P[6] genotypes were commonly circulated in Goa and G1P[8] and G1P[4] genotypes in Meghalaya. On nucleotide analysis, 6 samples from Goa showed G1 genotype specificity, while, 3 showed P[8] specificity indicating the G1P[8] rotavirus circulating in Goa. In Meghalaya state, 3 strains showed P[8] and 2 showed P[4] genotype specificity. The majority of the G and P genotypes were closely related to each other and G1 genotypes appeared in two separate clusters, while, P[8] and P[4] appeared in the respective clusters. Conclusion The circulation of G1P[8], G1P[6] genotypes in Goa and the presence of G1P[8] and G1P[4] genotypes in Meghalaya was observed.

show abstract

Section: Resultsmentioning

confidence: 83%

Section: Resultsmentioning

confidence: 99%

Section: Detection Of Rotavirus By Rna-page and Rt-pcrmentioning

confidence: 98%

See 1 more Smart Citation

Genotypic determination of human group A rotaviruses from Goa and Meghalaya states, India

Raorane

Dubal

Ghatak

et al. 2020

Heliyon

View full text Add to dashboard Cite

show abstract

“…cDNA was prepared from 500 ng of total RNA using Superscript II reverse transcriptase (Invitrogen) and random hexamer by incubating at 42°C for 1 hr. cDNA was amplified by conventional PCR method using specific primers ( vp1 , vp7 , vp4 , nsp3 , nsp4 , and nsp1) as mentioned in the previous study (Banerjee et al, ). As a normalising control, gapdh was used.…”

Section: Methodsmentioning

confidence: 99%

“…Short hairpin sequences targeting VP4 (Forward primer‐5′‐CCGGAATGGCGTTAATGACTTCAGTCTCGAGACTGAAGTCATTAACGCCATTTTTTTG‐3′; Reverse Primer‐5′‐AATTCAAAAAAATGGCGTTAATGACTTCAGTCTCGAGACTGAAGTCATTAACGCCAT‐3′) were generated with the siRNA Selection Program hosted by Whitehead Institute for Biomedical Research and inserted into PLKO.1‐TRC cloning vector (Addgene plasmid #10878; Moffat et al, ). Cells were transfected with VP4 shRNA using Lipofectamine 2000; VP4 knockdown efficiency was assessed by immunoblotting as well as RT‐PCR (primer sequence mentioned in Banerjee et al, ).…”

Section: Methodsmentioning

confidence: 99%

Biphasic regulation of RNA interference during rotavirus infection by modulation of Argonaute2

Mukhopadhyay

Chanda

Patra

et al. 2019

Cellular Microbiology

View full text Add to dashboard Cite

RNA interference (RNAi) is an evolutionary ancient innate immune response in plants, nematodes, and arthropods providing natural protection against viral infection. Viruses have also gained counter‐defensive measures by producing virulence determinants called viral‐suppressors‐of‐RNAi (VSRs). Interestingly, in spite of dominance of interferon‐based immunity over RNAi in somatic cells of higher vertebrates, recent reports are accumulating in favour of retention of the antiviral nature of RNAi in mammalian cells. The present study focuses on the modulation of intracellular RNAi during infection with rotavirus (RV), an enteric virus with double‐stranded RNA genome. Intriguingly, a time point‐dependent bimodal regulation of RNAi was observed in RV‐infected cells, where short interfering RNA (siRNA)‐based RNAi was rendered non‐functional during early hours of infection only to be reinstated fully beyond that early infection stage. Subsequent investigations revealed RV nonstructural protein 1 to serve as a putative VSR by associating with and triggering degradation of Argonaute2 (AGO2), the prime effector of siRNA‐mediated RNAi, via ubiquitin–proteasome pathway. The proviral significance of AGO2 degradation was further confirmed when ectopic overexpression of AGO2 significantly reduced RV infection. Cumulatively, the current study presents a unique modulation of host RNAi during RV infection, highlighting the importance of antiviral RNAi in mammalian cells.

show abstract

A decade‐long temporal analyses of human group‐A rotavirus among children with gastroenteritis: Prevaccination scenario in West Bengal, eastern India

Chawla‐Sarkar

Banerjee

et al. 2020

Journal of Medical Virology

View full text Add to dashboard Cite

Despite the significant reduction in the global infantile death toll due to rotaviral diarrhea, India still contributes substantially to rotavirus‐related hospitalization as well as mortality rates. The rotavirus surveillance study conducted from 2008 through 2017 among children (≤5 years) with moderate to severe gastroenteritis seeking healthcare facilities at two hospitals in eastern India, revealed a change in the proportion of rotavirus positivity, seasonality, and age‐group specificity along with the cycling of different usual and unusual genotypes in this endemic setting. G1 strains predominated during 2008‐2010, while G2 and G9 genotypes eventually upsurged during 2011‐2013. G1 strains re‐established their lead during 2013‐2015, while G3 emerged for the first time in eastern India in 2015 and rooted itself as the cardinal strain 2016 onwards. Evolutionary analyses of all the predominant genotypes (G1, G2, G3, and G9) revealed that they were mostly phylogenetically distant to the rotavirus vaccine strains as depicted in the phylogenetic dendrogram. These decade‐long epidemiological studies during the pre‐vaccination period in West Bengal (eastern India) underscore the cocirculation of multiple rotavirus genotypes in addition to sporadic occurrence of zoonotic strains like G10P[6] and G11P[25].

show abstract

Upsurge and spread of G3 rotaviruses in Eastern India (2014–2016): Full genome analyses reveals heterogeneity within Wa-like genomic constellation

Cited by 14 publications

References 48 publications

Genotypic determination of human group A rotaviruses from Goa and Meghalaya states, India

Genotypic determination of human group A rotaviruses from Goa and Meghalaya states, India

Biphasic regulation of RNA interference during rotavirus infection by modulation of Argonaute2

A decade‐long temporal analyses of human group‐A rotavirus among children with gastroenteritis: Prevaccination scenario in West Bengal, eastern India

Contact Info

Product

Resources

About