Unique Photobleaching Phenomena of the Twin-Arginine Translocase Respiratory Enzyme Chaperone DmsD

Abstract

DmsD is a chaperone of the redox enzyme maturation protein family specifically required for biogenesis of DMSO reductase in Escherichia coli. It exists in multiple folding forms, all of which are capable of binding its known substrate, the twin-arginine leader sequence of the DmsA catalytic subunit. It is important for maturation of the reductase and targeting to the cytoplasmic membrane for translocation. Here, we demonstrate that DmsD exhibits an irreversible photobleaching phenomenon upon 280 nm excitation irradiation. The phenomenon is due to quenching of the tryptophan residues in DmsD and is dependent on its folding and conformation. We also show that a tryptophan residue involved in DmsA signal peptide binding (W87) is important for photobleaching of DmsD. Mutation of W87, or binding of the DmsA twin-arginine signal peptide to DmsD in the pocket that includes W72, W80, and W91 significantly affects the degree of photobleaching. This study highlights the advantage of a photobleaching phenomenon to study protein folding and conformation changes within a protein that was once considered unusable in fluorescence spectroscopy.

A Functional Role for the Monomethylated Gln-51 and Lys-53 Residues of the 49GGQTK53 Motif of eL42 from Human 80S Ribosomes

“…At this stage, to rationalize the data obtained with the Biacore analyses, we have compared the position of the methylated GGQ motif in the 3-D structure of human eRF1 with that of the human eL42 protein. On one hand, we had previously modeled the human eL42 protein [ 23 ] into the structure of the archaeal ortholog extracted from the known X-ray structure of the 50S subunit of Haloarcula marismortui [ 27 ]. On the other hand, the crystal structure of human eRF1 is organized into three domains arranged into an overall Y-like shape [ 14 ].…”

“…A 5’ coding region of human eL42 (formerly RPL36A) was PCR amplified from pColdI-RPL36A [ 23 ] using a 5’ primer GCTCGGTACCCTCGAGGGATCC of pColdI, and a 3’primer CCTTTTTCCGGAAAATCGGATAGCCACT CTGCTTCC corresponding to a region of eL42 deleted of residues 49-GGQTK-53 respectively containing the Xho I and Bsp EI restriction sites (underlined). The digested Xho I– Bsp EI purified PCR fragment was then cloned in the corresponding sites of pColdI-RPL36A as a replacement of the wild type sequence leading to pcoldI-RPL36A(∆ GGQTK).…”

“…Competent Solu BL21 E. coli cells (AMS Biotechnology) were transformed with pcoldI-RPL36A(∆ GGQTK). His-tagged eL42-∆(GGQTK) was then expressed and purified as described for the purification of wild type eL42 [ 23 ].…”

“…To obtain quantitative kinetic measurements of the interactions between the eL42 protein and various partners, experiments were conducted on a Biacore 3000 instrument (GE Healthcare) of the Platform of Molecular Interactions of the IBPS Institute (Université Pierre et Marie Curie). All experiments were performed in triplicate, as described previously [ 23 ]. The interaction was analyzed between two partners: one partner immobilized on the sensor chip was called ligand.…”

NarJ subfamily system specific chaperone diversity and evolution is directed by respiratory enzyme associations

“…This indicates that greater selection pressures act upon the C-terminal half of DmsD proteins. Most experimentally determined residues involved in leader peptide interactions [ 56 , 57 ] and folding stability [ 58 , 59 ] occurred in the highly conserved region of DmsD emphasizing its importance (Fig. 5 and Additional file 5 : Figure S5).…”