Ultra-Low-Cost Integrated Silicon-based Transducer for On-Site, Genetic Detection of Pathogens

Abstract

Rapid screening and low-cost diagnosis play a crucial role in choosing the correct course of intervention e.g., drug therapy, quarantine, no action etc. when dealing with highly infectious pathogens. This is especially important if the disease-causing agent has no effective treatment, such as the novel coronavirus SARS-CoV-2 (the pathogen causing COVID-19), and shows no or similar symptoms to other common infections. We report a silicon-based integrated Point-of-Need (PoN) transducer (TriSilix) that can chemically-amplify and detect pathogen-specific sequences of nucleic acids (NA) quantitatively in real-time. Unlike other silicon-based technologies, TriSilix can be produced at wafer-scale in a standard laboratory; we have developed a series of methodologies based on metal-assisted chemical (wet) etching, electroplating, thermal bonding and laser-cutting to enable a cleanroom-free low-cost fabrication that does not require processing in an advanced semiconductor foundry. TriSilix is, therefore, resilient to disruptions in the global supply chain as the devices can be produced anywhere in the world. To create an ultra-low-cost device, the architecture proposed exploits the intrinsic properties of silicon and integrates three modes of operation in a single chip: i) electrical (Joule) heater, ii) temperature sensor (i.e. thermistor) with a negative temperature coefficient that can provide the precise temperature of the sample solution during reaction and iii) electrochemical sensor for detecting target NA. Using TriSilix, the sample solution can be maintained at a single, specific temperature (needed for isothermal amplification of NA such as Recombinase Polymerase Amplification (RPA) or cycled between different temperatures (with a precision of ±1.3 °C) for Polymerase Chain Reaction (PCR) while the exact concentration of amplicons is measured quantitatively and in real-time electrochemically. A single 4-inch Si wafer yields 37 TriSilix chips of 10×10×0.65 mm in size and can be produced in 7 hours, costing ~US $0.35 per device. The system is operated digitally, portable and low powercapable of running up to 35 tests with a 4000 mAh battery (a typical battery capacity of a modern smartphone). We were able to quantitatively detect a 563-bp fragment (Insertion Sequence IS900) of the genomic DNA of M. avium subsp.paratuberculosis (extracted from cultured field samples) through PCR in real-time with a Limit-of-(which was not certified by peer review)

Newly developed diagnostic methods for SARS-CoV-2 detection

“…Nunez-Bajo and his co-workers (2020) developed a silicon-based integrated Point-of-Need (PoN) transducer (TriSilix) that can detect SARS-CoV-2-specific sequences of nucleic acids quantitatively in real-time [58].…”

Microfluidic devices for the detection of viruses: aspects of emergency fabrication during the COVID-19 pandemic and other outbreaks

“…The limit of detection of the system was about 10 RNA copies per microlitre, which is comparable to benchtop assays [ 5 ]. Similar approaches to on-chip amplification of genetic fragments were tested for the detection of avian influenza DNA (H7N9) [ 107 ], influenza A (H1N1) [ 85 ], Zika (ZIKV) [ 101 ], dengue (DENV) [ 96 ], MERS (MERS-CoV) [ 81 ], SARS (SARS-CoV) [ 77 ] and COVID-19 (SARS-CoV-2) [ 79 ] ( table 1 ). These different studies show the great potential for microfluidics to replace or supplement benchtop assays for the diagnosis of infectious diseases.…”

“…: coronavirus SARS-CoV primer target were two regions of SARS genome, 15240–15612 and 17743–18349.5'-TAGGATTGCCTACGCAGACT-3', 5'-AGAGCCATGCCTAACATGCT-3′ (for the 240 bp product), and 5'-ATTGGCTGTAACAGCTTGAC-3' and 5'-TAG GGTAACCATTGACTTGG-3' (for the 438 bp product), respectively. [ 77 ] SARS-CoV-2 antibody SARS-CoV-2 spike antibody onto graphene [ 78 ] SARS-CoV-2 primer forward 5'- CCTA CTA AAT TAA ATG ATC TCT GCT TTA CT-3'reverse 5'- CAA GCT ATA ACG CAG CCT GTA -3' for synthetic 22,869 nucleotides of GenBank number MN908947 [ 79 ] MERS-CoV primer Orf1A protein: VIR13088F (forward) CGGCCUUCAACUGGUUGUUGUUVIR13089R (reverse) /5MAXN/AGCATAATTGTATGACCGCCAGTCN protein: VIR13090F (forward) CCUGUGUACUUCCUUCGGUACAGUVIR13091R (reverse) /5MAXN/GTAGGCATCAATATTTTGCTCAAGAAGC [ 80 ] MERS-CoV primer forward: MERcv- sF_ GAGCTTAGGCTCTTTAGTAAG,reverse: MERcv- sR_ TTTTTTTTTTTTGCAAATCATCTAATTAGCCTAAmore sequences of primers and probes are described in the original paper [ 81 ] MERS-CoV primer all the sequences are detailed in the Supplementary Material of the original article. [ 82 ] MERS-CoV oligonucleotide complementary DNA 5'-CGATTATGTGAAGAG-3', two-base-mismatch 5'-CGATTATCTGAGGAG-3', and non-complementary DNA 5'-TTCGCACAGTGGTCA-3'Probe: acpcPNA [ 83 ] MERS-CoV antibody anti-MERS-CoV NP #20 [ 84 ] Influenza …”

“…These elements can be added to the device [ 63 , 89 , 93 ], attached to the target element [ 84 , 90 , 132 ] or replicated during amplification steps [ 5 , 101 , 133 ]. Examples of fluorescent elements used in microfluidics are cyanine-5 (Cy5), methylene blue (MB) [ 79 ], fluorescein [ 77 ], fluorescein amidites (FAM), hexachlorinated fluorescein (HEX) [ 110 ], SYTO-82 [ 134 ], AF 488 [ 56 ], EvaGreen and SYBR Green [ 81 , 107 ]. Fluorescence is a very versatile method that can be used in different materials (e.g.…”

Arsenal of microfluidic testing devices may combat COVID-19 pandemic

“…Researchers from Imperial College London presented another way of making the fabrication of microdetectors more accessible in a non-peer-reviewed paper recently made available at bioRxiv. 11 Corresponding authors Estefania Nunez-Bajo and Firat Güder, with colleagues also from the University of Turku (Finland) and Moredun Research Institute (Scotland), proposed a silicon-based microdevice to chemically amplify and detect pathogenspecifi c nucleic acid sequences. Initial experiments were performed with synthetic SARS-CoV-2 since patient samples were not available.…”