Two new species of freshwater crabs of the genus Potamonautes MacLeay, 1838 (Decapoda: Brachyura: Potamonautidae) from the forests of KwaZulu-Natal, South Africa

Daniels, Savel R.; Busschau, Theo; Cumberlidge, Neil

doi:10.1093/jcbiol/ruz024

Cited by 10 publications

(19 citation statements)

References 45 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The primer pair LCOI‐1490 (5′‐GGTCAACAAATCATAAAGATATTG‐3′) and HCOI‐2198 (5′‐TAAACTTCAGGGTGACCAAAAAATCA‐3′) (Folmer et al, 1994) was used to amplify a partial fragment of the COI locus. Standard PCR conditions for amplification and DNA sequencing protocols were followed (for further details, consult Daniels et al, 2015) Two Potamonautes species, Potamonautes danielsi and Potamonautes isimangaliso , were used as out‐groups, as they are the known sister species of P. lividus (Daniels et al, 2019).…”

Section: Methodsmentioning

confidence: 99%

“…Standard PCR conditions for amplification and DNA sequencing protocols were followed (for further details, consult Daniels et al, 2015) Two Potamonautes species, Potamonautes danielsi and Potamonautes isimangaliso, were used as out-groups, as they are the known sister species of P. lividus (Daniels et al, 2019).…”

Section: Dna Extraction Polymerase Chain Reaction (Pcr) and Sequementioning

confidence: 99%

“…Several of the suspected distribution records of the species based on museum samples , such as False Bay Park in the iSimangaloso Wetlands area, have been described as a new species, Potamonautes isimangaliso (Peer et al, 2015 (Berliner, 2009;Cocks et al, 2000). In KwaZulu-Natal, P. lividus was col- IOCB forestappear to be narrow endemic species or are confined to a single locality and should be evaluated in future conservation assessments of the freshwater decapods (Daniels, 2017;Daniels et al, 2019;Peer et al, 2015). Similarly, several of the recently described freshwater crab species from elsewhere in the Afrotropical regions, such as Ethiopia and the African Great Lakes, appear to be narrow endemic taxa, and their conservation status must be reassessed (Cumberlidge & Clark, 2012, 2017Meyer & Cumberlidge, 2011).…”

Section: Distribution Of P Lividus and The Maxent Modelmentioning

confidence: 99%

“…Nevertheless, decapod diversity and alpha taxonomy in the Afrotropical region remain relatively poorly documented, considering that large areas have not been surveyed for decades owing to civil war, conflict, and general inaccessibility. Despite these drawbacks, there has recently been a steady and concerted effort to document freshwater crab diversity in the Afrotropical region, resulting in the description of a new genus and several species new to science, many of which are narrow endemic species (Cumberlidge & Daniels, 2014; Cumberlidge et al, 2019; Daniels, 2017; Daniels et al, 2019; Mvogo Ndongo et al, 2019; Peer et al, 2017; Peer et al, 2015; Phiri & Daniels, 2013; Wood & Daniels, 2016). Within the Afrotropical region, 28% of the 94 freshwater crabs assessed by Cumberlidge et al (2009) fall into one of the three major threatened groups: 14 species are Vulnerable (VU), 10 are Endangered (EN), and two are Critically Endangered (CR).…”

Section: Introductionmentioning

confidence: 99%

“…In southern Africa, a region that has been relatively well surveyed and in which the alpha taxonomy of freshwater crabs is well established, recent surveys of previously neglected habitat, such as forests, wetlands, and mountainous regions, have resulted in the description of 14 species, most of which are characterized by very restricted distribution ranges (Cumberlidge et al, 2016; Daniels, 2017; Daniels et al, 2019; Daniels & Bayliss, 2012; Daniels et al, 2014; Peer et al, 2015; Peer et al, 2017; Phiri & Daniels, 2013, 2014; Wood & Daniels, 2016). The IUCN Red Listing of the southern African freshwater crab fauna lists a single species, Potamonautes lividus , as VU (Cumberlidge & Daniels, 2008).…”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

Phylogeographic structure and continued surveys of a Vulnerable South African freshwater crab (Potamonautidae, Potamonautes lividus): Implications for the IUCN Red Listing of the Afrotropical fauna

Daniels

James

Gouws

2020

Aquatic Conservation

Self Cite

View full text Add to dashboard Cite

1. In the present study, the phylogeography of the only southern African freshwater crab listed as Vulnerable (VU) on the International Union for Conservation of Nature (IUCN) Red List, Potamonautes lividus, was investigated by surveying several localities in the Eastern Cape and KwaZulu-Natal provinces in South Africa. Both nuclear and mitochondrial DNA (nDNA and mtDNA) markers were used and, as it was hypothesized that marked genetic differentiation should be present, niche modelling was undertaken to explore the distribution of the species along the east coast of South Africa. In addition, shortfalls in the present approach to IUCN Red Listing, as illustrated by this Vulnerable species of crab, are discussed. 2. Results from the mtDNA revealed the presence of two haploclades, confined to specimens from the two provinces, respectively, and the general absence of maternal dispersal, a fact that was further validated by the fixation index (F ST) data and high Φ ST values. Within the Eastern Cape haploclade, low-frequency maternal dispersal occurred, corroborated by the low value of F ST. In contrast, no haplotypes were shared in the KwaZulu-Natal haploclade, as corroborated by the marked differences in F ST. 3. The microsatellite data demonstrated the presence of higher frequency, possibly paternally biased, dispersal of specimens between the Eastern Cape and KwaZulu-Natal provinces. The results suggest the presence of two distinct management units within P. lividus. An estimate of divergence time suggests a late Pleistocene cladogenesis between the Eastern Cape and KwaZulu-Natal haploclades. 4. Considering the presence of P. lividus in several newly formed nature conservation areas in both provinces, and its potential presence in the intermediary area, based on maximum entropy (Maxent) niche modelling, our data suggest that the species status in the IUCN Red List should be downgraded to Least Concern. 5. A comparison of all the Endangered, Vulnerable, and Critically Endangered IUCN Red Listed freshwater crabs for the entire Afrotropical region reveals the lack of recent sampling in the three biodiversity hot spots in West, Central, and East

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Dna Extraction Polymerase Chain Reaction (Pcr) and Sequementioning

confidence: 99%

Section: Distribution Of P Lividus and The Maxent Modelmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Phylogeographic structure and continued surveys of a Vulnerable South African freshwater crab (Potamonautidae, Potamonautes lividus): Implications for the IUCN Red Listing of the Afrotropical fauna

Daniels

James

Gouws

2020

Aquatic Conservation

Self Cite

View full text Add to dashboard Cite

show abstract

Metabarcoding unsorted kick‐samples facilitates macroinvertebrate‐based biomonitoring with increased taxonomic resolution, while outperforming environmental DNA

et al. 2020

View full text Add to dashboard Cite

While previous studies have highlighted the potential of DNA‐based methods for the biomonitoring of freshwater macroinvertebrates, a limited number have investigated homogenization of bulk samples that include debris, in order to reduce sample‐processing costs. This study explores the use of several DNA‐based survey methods for water quality and biodiversity assessment in South Africa, comparing morphological and molecular‐based identification of freshwater macroinvertebrates at the family level and the level of molecular operational taxonomic units (mOTUs). Seven sites were studied across three rivers with four different sample types collected per site: a standard SASS biomonitoring sample split into a picked sample (also used for morphological identification) and a leftover debris sample; a more intensive‐search comprehensive sample; and a filtered water eDNA sample. DNA‐based methods recovered higher diversity than morphology, but did not always recover the same taxa, even at the family level. Regardless of the differences in SASS taxon scores, most DNA‐based methods, except a few eDNA samples, returned the same water quality assessment category as the standard morphology‐based assessment. Homogenized comprehensive samples recovered more freshwater invertebrate diversity than all other methods, suggesting the standardized SASS method overlooks taxa. The eDNA samples recovered more diversity than any other method; however, 90% of the reads were nontarget and as a result eDNA recovered the lowest target (macroinvertebrate) diversity. However, eDNA did find some target taxa that all other methods failed to detect. This study shows that unsorted bulk samples have the potential to be used for water quality biomonitoring, providing higher diversity estimates for macroinvertebrates than either SASS picked or eDNA samples. These results also show the value of incorporating DNA‐based approaches into existing South African metrics, providing additional taxonomic resolution to develop more refined metrics for biodiversity management.

show abstract

Comparison of the mitochondrial phylogeographical structure of a generalist and two specialist frog species reveals contrasting patterns in the Eastern and Western Cape provinces of South Africa

Kushata

Conradie

Cherry

et al. 2020

Biological Journal of the Linnean Society

View full text Add to dashboard Cite

In this study, we examined the phylogeographical structure of three frog species (Anhydrophryne rattrayi, Arthroleptis wageri and Cacosternum nanum) in the Eastern and Western Cape provinces of South Africa. The first two species are forest dwelling and exhibit direct development, whereas the last species is a habitat generalist, breeding in open freshwater bodies and exhibiting rapid metamorphosis. Evolutionary relationships were inferred using combined mitochondrial DNA (mtDNA) sequence data [16S rRNA and cytochrome b (Cytb)]. Divergence times were estimated for each species using the combined mtDNA dataset, and population genetic structuring was inferred using haplotype networks and analysis of molecular variance using the rapidly evolving Cytb locus. The two forest-dwelling species (Anhydrophryne rattrayi and Arthroleptis wageri) each revealed two statistically well-supported clades and were characterized by marked genetic differentiation and the general absence of shared maternal haplotypes, indicating no maternal gene flow between conspecific populations; a result corroborated by moderate values of pairwise genetic distance. In contrast, for the generalist species C. nanum, two shallow clades were observed and several haplotypes were shared between localities, indicating moderate maternal gene flow. Diversification in the two forest-dwelling species occurred during the Plio-Pleistocene climatic oscillations and was associated with increased xeric conditions, whereas in C. nanum a recent, Holocene divergence was inferred. Ancient climatic factors thought to be causal in the divergences within each of the three species are discussed. The marked mtDNA differentiation in the two forest specialist species suggests the presence of distinct management units that should be considered in future conservation management decisions.

show abstract

Two new species of freshwater crabs of the genus Potamonautes MacLeay, 1838 (Decapoda: Brachyura: Potamonautidae) from the forests of KwaZulu-Natal, South Africa

Cited by 10 publications

References 45 publications

Phylogeographic structure and continued surveys of a Vulnerable South African freshwater crab (Potamonautidae, Potamonautes lividus): Implications for the IUCN Red Listing of the Afrotropical fauna

Phylogeographic structure and continued surveys of a Vulnerable South African freshwater crab (Potamonautidae, Potamonautes lividus): Implications for the IUCN Red Listing of the Afrotropical fauna

Metabarcoding unsorted kick‐samples facilitates macroinvertebrate‐based biomonitoring with increased taxonomic resolution, while outperforming environmental DNA

Comparison of the mitochondrial phylogeographical structure of a generalist and two specialist frog species reveals contrasting patterns in the Eastern and Western Cape provinces of South Africa

Contact Info

Product

Resources

About