Two copies of the human apolipoprotein C-I gene are linked closely to the apolipoprotein E gene.

Lauer, S J; Walker, David W.; Elshourbagy, Nabil A.; Reardon, Catherine A.; Levy-Wilson, Beatriz; Taylor, John M.

doi:10.1016/s0021-9258(18)68638-7

Cited by 126 publications

(29 citation statements)

References 46 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Apolipoprotein CI (APOC1) is located downstream of ApoE in chromosome 19. 1 Both genes affect macrophage lipoprotein homeostasis and may be derived from a common source. 1 Although ApoE and APOC1 polymorphisms have been studied in various ethnic groups, their association is not well understood.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Association of Apolipoproteins E4 and C1 With Onset Age and Memory: A Study of Sporadic Alzheimer Disease in Taiwan

Chuang

Hsieh

Wang

et al. 2010

J Geriatr Psychiatry Neurol

View full text Add to dashboard Cite

show abstract

Section: Introductionmentioning

confidence: 99%

“…1 Both genes affect macrophage lipoprotein homeostasis and may be derived from a common source. 1 Although ApoE and APOC1 polymorphisms have been studied in various ethnic groups, their association is not well understood. 2 The clinical or neuropsychological manifestations of APOC1, especially in mild cases of AD, is also unclear.…”

Section: Introductionmentioning

confidence: 99%

Association of Apolipoproteins E4 and C1 With Onset Age and Memory: A Study of Sporadic Alzheimer Disease in Taiwan

Chuang

Hsieh

Wang

et al. 2010

J Geriatr Psychiatry Neurol

View full text Add to dashboard Cite

show abstract

“…Due to this pleiotropic effect on TGs and cholesterol regulation, investigators have tried to dissect ApoC-I's potential role in atherosclerosis, which appears to be highly context dependent. A number of observations indicate that ApoC-I levels are elevated in atherosclerotic lesions which is predictive for disease progression and has a bearing on foam cell formation [87,123]. Increased ApoC-I content in remnant particles has been proposed as an independent marker for estimating risk of coronary heart disease (CHD) [124,125].…”

Section: Overexpression Of Apolipoprotein C-i Leads To Severe Htg In Both Lpl Dependent and Lpl-independent Mannermentioning

confidence: 99%

The Importance of Lipoprotein Lipase Regulation in Atherosclerosis

et al. 2021

View full text Add to dashboard Cite

Lipoprotein lipase (LPL) plays a major role in the lipid homeostasis mainly by mediating the intravascular lipolysis of triglyceride rich lipoproteins. Impaired LPL activity leads to the accumulation of chylomicrons and very low-density lipoproteins (VLDL) in plasma, resulting in hypertriglyceridemia. While low-density lipoprotein cholesterol (LDL-C) is recognized as a primary risk factor for atherosclerosis, hypertriglyceridemia has been shown to be an independent risk factor for cardiovascular disease (CVD) and a residual risk factor in atherosclerosis development. In this review, we focus on the lipolysis machinery and discuss the potential role of triglycerides, remnant particles, and lipolysis mediators in the onset and progression of atherosclerotic cardiovascular disease (ASCVD). This review details a number of important factors involved in the maturation and transportation of LPL to the capillaries, where the triglycerides are hydrolyzed, generating remnant lipoproteins. Moreover, LPL and other factors involved in intravascular lipolysis are also reported to impact the clearance of remnant lipoproteins from plasma and promote lipoprotein retention in capillaries. Apolipoproteins (Apo) and angiopoietin-like proteins (ANGPTLs) play a crucial role in regulating LPL activity and recent insights into LPL regulation may elucidate new pharmacological means to address the challenge of hypertriglyceridemia in atherosclerosis development.

show abstract

“…Genotypic status for the Hpa I apoC-I promoter polymorphism was determined by twostep nested polymerase chain reaction (PCR) followed by restriction digestion with Hpa I and electrophoresis on 1.5% agarose (ultraPure Agarose, Life Technologies, Gaithersburg, MD). The sequence of the upstream external primer was GCATGCAGCC CCCAGTCACGCATCCCCTGC and began at Ϫ 492 relative to the apoC-I gene start site (16). The downstream external primer was GAATCCTTGCTGGAGGGCTTGGTTGGGAGGT and corresponded to the first exon.…”

Section: Apoe and Apoc-i Genotypingmentioning

confidence: 99%

A common Hpa I RFLP of apolipoprotein C-I increases gene transcription and exhibits an ethnically distinct pattern of linkage disequilibrium with the alleles of apolipoprotein E

Xu¹,

Berglund²,

Ramakrishnan

et al. 1999

Journal of Lipid Research

View full text Add to dashboard Cite

Apolipoprotein (apo) C-I is a constituent of triglyceride-rich lipoproteins (TGRL) that interferes with their hepatic clearance. Functional polymorphism in the apoC-I gene has not been established. We determined that an Hpa I site variably present at ؊ 317 relative to the apoC-I gene is produced by a 4-bp CGTT insertion. The apoC-I Hpa I alleles showed an ethnically distinct pattern of linkage disequilibrium with the alleles of the adjacent apoE gene. The frequency of apoC-I Hpa I-positive (H2) with apoE 2 was 0.98, without significant ethnic difference. In contrast, the frequency of H2 with apoE 4 was 0.85 in European-Americans but only 0.55 in African-Americans ( P Ͻ 0.001). The frequency of H2 with apoE 3 was 0.02 in European-Americans and 0.08 in African-Americans ( P Ͻ 0.001). African-American apoE 3/ 3 carriers of apoC-I H2 had 19% lower fasting triglyceride levels than H1 homozygotes ( P ‫؍‬ 0.03) along with 18% higher HDL-cholesterol levels ( P ‫؍‬ 0.02). ApoB levels were 21% lower ( P ‫؍‬ 0.002). H2-allelic reporter-gene constructions showed 50% higher expression in transient transfection studies. We localized the source of this difference in expression to the CGTT insertion itself. Deletion studies of the H1 allele showed a negative transcriptional effect of the polymorphic region. An H1 oligodeoxynucleotide showed specific binding of a hepatomacell nuclear protein not evident with an H2 oligodeoxynucleotide. The H2 sequence may decrease the binding of a negatively acting transcription factor, leading to overexpression of apoC-I. This may produce a functional effect on lipoprotein levels but confirmation is needed in other populations. -Xu, Y.

show abstract

Two copies of the human apolipoprotein C-I gene are linked closely to the apolipoprotein E gene.

Cited by 126 publications

References 46 publications

Association of Apolipoproteins E4 and C1 With Onset Age and Memory: A Study of Sporadic Alzheimer Disease in Taiwan

Association of Apolipoproteins E4 and C1 With Onset Age and Memory: A Study of Sporadic Alzheimer Disease in Taiwan

The Importance of Lipoprotein Lipase Regulation in Atherosclerosis

A common Hpa I RFLP of apolipoprotein C-I increases gene transcription and exhibits an ethnically distinct pattern of linkage disequilibrium with the alleles of apolipoprotein E

Contact Info

Product

Resources

About