Transgenic expression of Cre recombinase in mitral/tufted cells of the olfactory bulb

Abstract

Olfactory information is conveyed from the periphery to the olfactory cortices through mitral and tufted (M/T) cells in the olfactory bulb. A mouse with a specific expression of Cre recombinase in M/T cells is essential for genetic marking of M/T cells and manipulating their properties. Protocadherin 21 (Pcdh21) expression is highly restricted to M/T cells. Here we report a transgenic mouse line, Pcdh21-Cre, in which 10-kb mouse Pcdh21 promoter drives the expression of Cre recombinase. In Pcdh21-Cre mice, Cre recombinase activity is predominantly detected in M/T cells, visualized with the anti-CFP immunostaining in offspring of a cross between Pcdh21-Cre and the reporter Rosa26-loxP-stop-loxP-CFP strain. These results demonstrate that the 10-kb Pcdh21 promoter can drive transcription in M/T cells and Pcdh21-Cre mice can be used to excise floxed DNA fragments in M/T cells, which provides a valuable tool to reveal the structure and function of the central olfactory circuits.

Development and topography of the lateral olfactory tract in the mouse: Imaging by genetically encoded and injected fluorescent markers

“…The NT-GFP mouse strain may greatly aid in screening for molecules involved in LOT establishment and collateral branching. Recently, a mouse line was reported that expresses Cre recombinase almost exclusively within M/T cells in both the MOB and the accessory olfactory bulb, using the protocadherin 21 promoter (Nagai et al, 2005). When crossed to a reporter strain, a staining pattern that is very similar to the NT-GFP mouse was detected in the MOB and LOT of young mice.…”

Striatal Medium Spiny Neurons Terminate in a Distinct Region in the Lateral Hypothalamic Area and Do Not Directly Innervate Orexin/Hypocretin- or Melanin-Concentrating Hormone-Containing Neurons

“…A DNA fragment containing the tetO promoter (Gossen and Bujard, 1992) followed by an ecliptic synaptopHluorin (kindly gifted by Dr. Miesenbock, Yale University, New Haven, CT) (Miesenbock et al, 1998) and a rabbit ␤-globin intron/ polyadenylation signal was excised from the vector by digestion at insertflanking AscI sites, gel purified, and microinjected into the pronuclei of fertilized eggs from C57BL/6CrSlc mice (provided by Japan SLC, Hamamatsu, Japan) to generate tetO-synaptopHluorin transgenic mice, as described previously (Nagai et al, 2005). The genotype of the animals was determined by PCR of tail genomic DNA with primers unique to the transgene (5Ј-CTTTTCACTGGAGTTGTCCCAATTC, 5Ј-CCAAT TTGTGTCCAAGAATGTTTCC).…”

“…The tissue was then frozen in OCT compound (Tissue-Tek; Sakura, Tokyo, Japan), and 30 -40 m parasagittal or coronal sections were cut on a cryostat. Sections were treated according to standard histochemistry protocols, as described previously (Nagai et al, 2005). Primary antibodies against vesicular GABA transporter (VGAT) (1:2000; Millipore, Temecula, CA), gephyrin (1:300; Synaptic Systems, Goettingen, Germany), MCH (1:3000; Millipore), and orexin-A, and -B (1:20000; kindly gifted from Dr.…”

RNA-seq analysis of developing olfactory bulb projection neurons

“…As anticipated, the GFP+ cell population showed significant expression of 11 genes that are known to express in developing OB projection neurons. These genes include Tbr1 , Eomes (also known as Tbr2) (Imamura and Greer, 2013), Cdhr1 ( Pcdh21 ) (Nagai et al, 2005), Slc17a7 ( vGluT1) (Gabellec et al, 2007), Tfap2e (AP2ε) (Feng et al, 2009), Reelin (Imamura et al, 2006), Emx1, Emx2 (Mallamaci et al, 1998), Sall1 (Harrison et al, 2007), Nrp1 , and L1cam (Inaki et al, 2004). While less or no expression was observed for 12 genes whose expression in OB projection neurons is not observed.…”