Transgelin, a p53 and PTEN-Upregulated Gene, Inhibits the Cell Proliferation and Invasion of Human Bladder Carcinoma Cells In Vitro and In Vivo

Abstract

Transgelin (TAGLN/SM22-α) is a regulator of the actin cytoskeleton, affecting the survival, migration, and apoptosis of various cancer cells divergently; however, the roles of TAGLN in bladder carcinoma cells remain inconclusive. We compared expressions of TAGLN in human bladder carcinoma cells to the normal human bladder tissues to determine the potential biological functions and regulatory mechanisms of TAGLN in bladder carcinoma cells. Results of RT-qPCR and immunoblot assays indicated that TAGLN expressions were higher in bladder smooth muscle cells, fibroblast cells, and normal epithelial cells than in carcinoma cells (RT-4, HT1376, TSGH-8301, and T24) in vitro. Besides, the results of RT-qPCR revealed that TAGLN expressions were higher in normal tissues than the paired tumor tissues. In vitro, TAGLN knockdown enhanced cell proliferation and invasion, while overexpression of TAGLN had the inverse effects in bladder carcinoma cells. Meanwhile, ectopic overexpression of TAGLN attenuated tumorigenesis in vivo. Immunofluorescence and immunoblot assays showed that TAGLN was predominantly in the cytosol and colocalized with F-actin. Ectopic overexpression of either p53 or PTEN induced TAGLN expression, while p53 knockdown downregulated TAGLN expression in bladder carcinoma cells. Our results indicate that TAGLN is a p53 and PTEN-upregulated gene, expressing higher levels in normal bladder epithelial cells than carcinoma cells. Further, TAGLN inhibited cell proliferation and invasion in vitro and blocked tumorigenesis in vivo. Collectively, it can be concluded that TAGLN is an antitumor gene in the human bladder.

Maspin is a PTEN-Upregulated and p53-Upregulated Tumor Suppressor Gene and Acts as an HDAC1 Inhibitor in Human Bladder Cancer

“…The 5 -deletion report assays demonstrated that p53-induced maspin expression in bladder carcinoma cells was dependent on the 5 -flanking region fragment (−567 to −162) of the human maspin gene (Figure 7). Our study is consistent with a previous report that identified two p53 binding sites (GGCATGTTGGAGGCCTTTG and GGACAAGCTGCCAAGAGGCTTGAGT) in the promoter of the human maspin gene [40]. However, our study indicated that p53 may affect the reporter activity of the reporter vector containing the DNA fragment (−567 to −363), which does not have a putative p53 binding site.…”

“…However, no report has been published on the effect of PTEN on maspin expression in bladder cancer. The results of the present study indicated that PTEN modulated the cell growth of bladder carcinoma cells in vitro and in vivo, which is consistent with the results of other studies [39,40]. The immunoblot assays revealed that PTEN downregulated Akt phosphorylation at both S473 and T308, whereas treatment with VO-OHpic trihydrate, which is a PTEN activity inhibitor, reversed the results.…”

“…The p53 and PTEN expression vectors were constructed. p53-overexpressed HT1376 (HT-p53) cells and PTEN-overexpression T24 (T24-PTEN) cells were cloned as described previously [40].…”

A metabolic shift to glycolysis promotes zebrafish tail regeneration through TGF–β dependent dedifferentiation of notochord cells to form the blastema

“…Furthermore, its expression has been detected in cancer stem cells and has been implicated in their migration and invasion [57]. Paradoxically, trangelin has been described as both promoting and inhibiting bladder cancer [58,59]. The paradox is potentially resolved if timing and transient transgelin expression is important in the progression of bladder cancer as it is in the formation of a blastema.…”

Proteomic Profiling of Colon Cancer Tissues: Discovery of New Candidate Biomarkers

“…Moreover, it is actively involved in the actin-cytoskeletal rearrangements regulating cell migration, podosome formation, tissue invasion, and matrix remodeling [52,53]. TAGL is associated with a specific sub-population of actin filament bundles, and its depletion increased the capacity of cells to form podosomes, increased the actin dynamics, and enhanced the tumorigenic properties of cells [54,55]. Most studies reported that TAGL acts as a tumor suppressor [56], inhibiting cell migration, suppressing the 92-kDa type IV collagenase (MMP-9) [57], and being down-regulated by the Ras pathway [58] as well as silenced through epigenetic mechanisms, which involve TAGL promoter hypermethylation [59,60].…”