Maspin is a PTEN-Upregulated and p53-Upregulated Tumor Suppressor Gene and Acts as an HDAC1 Inhibitor in Human Bladder Cancer

Lin, Yu‐Hsiang; Tsui, Ke-Hung; Chang, Kang-Shuo; Hou, Chen-Pang; Feng, Tsui-Hsia; Juang, Horng‐Heng

doi:10.3390/cancers12010010

Cited by 15 publications

(20 citation statements)

References 48 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…On the other hand, the clone DO7, also used in the present study, can detect only truncated mutations in exons 9 and 10[ 12 , 17 ]. Interaction between p53 and Maspin, which was previously proved for colorectal, prostate and bladder cancer[ 10 , 18 , 19 ], was partially confirmed in this study, for GC.…”

Section: Discussionsupporting

confidence: 84%

“…In bladder and prostate cancer, p53 was found to upregulate Maspin expression and stimulate cisplatin-induced apoptosis[ 19 ]. Knockdown of Maspin in p53 wt carcinoma cells stimulates tumor cell proliferation[ 19 ].…”

Section: Discussionmentioning

confidence: 99%

“…Although it was shown that two p53 binding sites are responsible for promoting the human Maspin gene: GGCATGTTGGAGGCCTTTG and GGACAAGCTGCCAAGAGGCTTGAGT[ 2 , 19 , 21 ], no relevant data on the Maspin-p53 interaction have been published for GC. The present study suggests that knockdown of Maspin might be induced by G:C→A:T transition in exon 7 of the TP53 gene.…”

Section: Discussionmentioning

confidence: 99%

See 2 more Smart Citations

Maspin subcellular expression in wild-type and mutant TP53 gastric cancers

Gurzu¹,

Jung²,

Sugimura³

et al. 2020

WJGO

View full text Add to dashboard Cite

BACKGROUND Although the role of p53 in the evolution and prognosis of gastric cancer (GC) has been extensively examined, the exact mechanism of action is incompletely understood. In the last years, p53-target genes were supposed to be involved in the p53 pathway. One of them is the tumor-suppressor gene Maspin, which codifies the protein with the same name. Maspin activity depends on its subcellular localization. To our knowledge, the possible role of TP53 gene in Maspin subcellular localization, in GC cells, has not yet been studied in a large number of human samples. AIM To evaluate the possible role of wild-type and mutated p53 in Maspin subcellular localization. METHODS The present study included 266 consecutive patients with GC in which TP53 gene status, and mutations in exons 2 to 11, respectively, were analyzed and correlated with immunohistochemical expression of p53 and Maspin. RESULTS None of the 266 cases showed mutations in exon 9. The rate of TP53 mutations was 33.83%. The mutation rate was slightly higher in distally-located GCs, with a lower degree (≤ 5 buds/ high power fields) of dyscohesivity ( P < 0.01). The wild-type cases had a longer survival, compared with mutant GCs, especially in patients without lymph node metastases, despite the high depth of tumor infiltration ( P = 0.01). The Dukes-MAC-like staging system was proved to have the most significant independent prognostic value ( P < 0.01). The statistical correlations proved that TP53 gene mutations in exon 7 might induce knockdown of Maspin, but wild-type p53 can partially restore nuclear Maspin expression and decrease the metastatic potential of gastric adenocarcinoma cells. CONCLUSION Downregulated Maspin might be induced by mutations in exon 7 of the TP53 gene but wild-type p53 can partially restore nuclear Maspin expression. These findings should be proved in experimental studies.

show abstract

Section: Discussionsupporting

confidence: 84%

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Maspin subcellular expression in wild-type and mutant TP53 gastric cancers

Gurzu¹,

Jung²,

Sugimura³

et al. 2020

WJGO

View full text Add to dashboard Cite

show abstract

“…Cells were cultured in a serum-free medium for 24 h, then incubated for another 24 h in a 10% medium before incubation with EdU (5-ethynyl-2′-deoxyuridine; 10 µM) for 2 h. Subsequently, the cells were collected by trypsin-EDTA and centrifuged at 500 g for 10 min, then analyzed using Click-iT EdU Flow Cytometry Assay Kits (Thermo Fisher Scientific Inc. Waltham, MA, USA) as described previously [ 30 ].…”

Section: Methodsmentioning

confidence: 99%

Mucosa-Associated Lymphoid Tissue 1 Is an Oncogene Inducing Cell Proliferation, Invasion, and Tumor Growth via the Upregulation of NF-κB Activity in Human Prostate Carcinoma Cells

et al. 2021

Self Cite

View full text Add to dashboard Cite

Prostate cancer is one of the most common seen malignancies and the leading cause of cancer-related death among men. Given the importance of early diagnosis and treatment, it is worth to identify a potential novel therapeutic target for prostate cancer. Mucosa-associated lymphoid tissue 1 (MALT1) is a novel gene involved in nuclear factor κB (NF-κB) signal transduction by acting as an adaptor protein and paracaspase, with an essential role in inflammation and tumorigenesis in many cancers. This study investigated the functions and the potential regulatory mechanisms of MALT1 in the human prostate cancer cells. We found that MALT1 is abundant in prostate cancer tissues. MALT1 facilitated NF-κB subunits (p50 and p65) nuclear translocation to induce gene expression of interleukin 6 (IL-6) and C-X-C motif chemokine 5 (CXCL5) in prostate carcinoma cells. MALT1 promoted cell proliferation, invasion, and tumor growth in vitro and in vivo. MALT1 enhanced NF-κB activity in prostate carcinoma cells; moreover, NF-κB induced MALT1 expression determined by reporter and immunoblot assays, implying there is a positive feedback loop between MALT1 and NF-κB. In conclusion, MALT1 is a NF-κB-induced oncogene in the human prostate carcinoma cells.

show abstract

“…Animals were anesthetized intraperitoneally and equal volumes of cells (8× 10 6 /100 µL) were injected subcutaneously on the side of the back. Tumor volume was measured at three-day intervals using vernier calipers and calculated as π/6 × larger diameter × (smaller diameter) 2 , as described previously [31].…”

Section: Xenograft Animal Studymentioning

confidence: 99%

Human Heme Oxygenase-1 Induced by Interleukin-6 via JAK/STAT3 Pathways Is a Tumor Suppressor Gene in Hepatoma Cells

et al. 2020

Self Cite

View full text Add to dashboard Cite

Heme oxygenase-1 (HO-1) has several important roles in hepatocytes in terms of anti-inflammation, anti-apoptosis, and antioxidant properties. Interleukin-6 (IL-6) is a pleiotropic cytokine associated with liver regeneration and protection against injury. The aim of this study was to determine the potential crosstalk between HO-1 and IL-6, and to elucidate the signaling pathways involved in the induction of HO-1 by IL-6 in human hepatoma cells. Ectopic overexpression of HO-1 not only attenuated cell proliferation in vitro and in vivo, but also blocked the reactive oxygen species (ROS) induced by H2O2 and the pyocyanin in HepG2 or Hep3B cells. IL-6 expression was negatively regulated by HO-1, while IL-6 induced signal transducer and activator of transcription 3 (STAT3) phosphorylation and HO-1 gene expression in HepG2 cells. The co-transfected HO-1 reporter vector and a protein inhibitor of the activated STAT3 (PIAS3) expression vector blocked the IL-6-induced HO-1 reporter activity. Both interferon γ and interleukin-1β treatments induced STAT1 but not STAT3 phosphorylation, which had no effects on the HO-1 expression. Treatments of AG490 and luteolin blocked the JAK/STAT3 signaling pathways which attenuated IL-6 activation on the HO-1 expression. Our results indicated that HO-1 is the antitumor gene induced by IL-6 through the IL-6/JAK/STAT3 pathways; moreover, a feedback circuit may exist between IL-6 and HO-1 in hepatoma cells.

show abstract

Maspin is a PTEN-Upregulated and p53-Upregulated Tumor Suppressor Gene and Acts as an HDAC1 Inhibitor in Human Bladder Cancer

Cited by 15 publications

References 48 publications

Maspin subcellular expression in wild-type and mutant TP53 gastric cancers

Maspin subcellular expression in wild-type and mutant TP53 gastric cancers

Mucosa-Associated Lymphoid Tissue 1 Is an Oncogene Inducing Cell Proliferation, Invasion, and Tumor Growth via the Upregulation of NF-κB Activity in Human Prostate Carcinoma Cells

Human Heme Oxygenase-1 Induced by Interleukin-6 via JAK/STAT3 Pathways Is a Tumor Suppressor Gene in Hepatoma Cells

Contact Info

Product

Resources

About