Transcriptional properties of eight synthetic pathogen-inducible promoters in transgenic Arabidopsis thaliana

Huang, Zhenchi; Peng, Shushi; Li, H.; Fu-hua, Zeng

doi:10.1007/s10535-016-0665-8

Cited by 4 publications

(12 citation statements)

References 17 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Promoters are particular DNA sequences located upstream of the 5′ end of the coding regions, which initiate gene transcription by combining with RNA polymerase and regulate the expression mode and level of downstream structural genes [ 7 ]. Hence, the promoter region determines when and where the gene of interest will be expressed within the organism.…”

Section: Introductionmentioning

confidence: 99%

“…GWSF (374-bp), named for its four cis-element dimers, was a highly efficient SPIP (synthetic pathogen-inducible promoter) capable of causing rapid responses to a wide range of pathogens [ 7 ]. In the GWSF promoter, four pathogen-inducible cis-elements were present (GST1-box, W-box, S-box, and F-box) and a minimal cauliflower mosaic virus 35S promoter (−46 to +8 TATA box) ( Figure 1 ).…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Expression Activity of Artificial Promoters for Disease Resistance in Transgenic Eucalyptus urophylla

Huang

Fang

et al. 2022

Genes

View full text Add to dashboard Cite

The transcriptional properties of artificial promoters are closely related to the type and arrangement position of cis-elements. GWSF (374-bp) was an effective SPIP with four cis-element dimers. There were four pathogen-inducible cis-elements in the GWSF promoter (GST1-boxes, W-boxes, S-boxes, and F-boxes) and a minimal cauliflower mosaic virus 35S promoter. V-element dimers were inserted into the upstream (VGWSF), midstream (GWVSF), and downstream (GWSFV) regions of the original GWSF promoter sequence to examine their affect on the position. The expression activity of promoters was analyzed and estimated using the histochemical staining of leaf discs of eucalyptus with transient expression, an image digitization method to extract the color features, and the induction treatment by a plant pathogenic microorganism/inducer and qPCR assays. The histochemical staining results of the adventitious buds indicated that the promoters had been successfully integrated into the E.urophylla genome and that they drove the expression of the gus gene. There was a noticeable difference in the intensity of color between the adventitious buds on the same callus block, as well as the intensity of color within the same adventitious bud. According to the established two-factor model of blue value, there was a greater difference between the levels of the genotype factor than the promoter factor in eucalyptus leaf discs. Further, the basal and inducible transcriptional levels of the three improved promoters were investigated by qPCR. With the basal transcriptional level of the GWSF promoter normalized to one, the relative basal levels of VGWSF, GWVSF, and GWSFV were 1.40, 1.45, and 4.15, respectively. The qPCR results were consistent with the staining results of GUS histochemical staining. The three improved promoters all had the properties of being induced by salicylic acid, Ralstonia solanacearum, and Phytophthora capsici. The three improved promoters demonstrated a significantly higher TMV induction activity: their induction activity from high to low was GWSFV > GWVSF > VGWSF. The findings will be beneficial to the construction and optimization of artificial promoters for transgenic plants.

show abstract

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Expression Activity of Artificial Promoters for Disease Resistance in Transgenic Eucalyptus urophylla

Huang

Fang

et al. 2022

Genes

View full text Add to dashboard Cite

show abstract

“…The space between the cis-elements and the preinitiation complex has a sound effect and the space will be difficult to predict (Hernandez-Garcia and Finer 2014). In addition, permutation and combination of cis-elements has a significant impact on transcriptional properties of SPIP (Huang et al 2017). In our opinion, transcription properties of promoter synthesis are difficult to predict and they need to be experimentally verified by expression analysis.…”

mentioning

confidence: 99%

“…In previous studies, we designed and verified the GWSF promoter which had the advantages of low background expression, rapid response, efficient transcriptional activity, especially, responding to bacteria, fungi, salicylic acid (SA), and ethylene (Eth) (Huang et al 2017, Huang and. Herein, the GWSF was optimized by inserting V-box at a different positions.…”

mentioning

confidence: 99%

See 1 more Smart Citation

Effect of virus inducible cis-element insertion on transcription properties of improved GWSF promoter in Arabidopsis thaliana

Huang¹,

Li²

2020

Biologia plant.

Self Cite

View full text Add to dashboard Cite

An ideal synthetic promoter can accurately regulate gene expression and the minimal cauliflower mosaic virus 35S promoter (GWSF) is an ideal synthetic pathogen-inducible promoter (SPIP) with several advantages. Three modified SPIPs, named as VGWSF, GWVSF, and GWSFV according to the arrangement of cis-elements, were optimized by inserting the dimer of a virus inducible cis-element (TTGGGAAGGAATTTCCTACT, V-box) upstream, midstream, or downstream the GWSF sequence. The three promoters were used to replace the cauliflower mosaic virus 35S promoter in the plasmid pBI121 in order to control the expression of the β-glucuronidase (gus) gene. Transformation of Arabidopsis thaliana (ecotype Col-0) plants was performed via the Agrobacterium tumefaciens strain GV3101 by the floral dip method. The five-week-old transgenic T3 lines were histochemically stained for GUS activity to evaluate the transcriptional properties of modified SPIPs. The VGWSF and GWVSF had low basal expressions and could not be induced by low or high temperatures and a low osmotic potential but could be induced by the tobacco mosaic virus (TMV). Although GWSFV had the highest GUS activity, it showed a substantial basal expression. After being treated with TMV, abscisic acid (ABA), salicylic acid (SA), or ethylene (Eth) for12 h, the expressions of modified SPIPs were evaluated by real-time quantitative PCR. With the basal expression of GWSF as a reference, each treatment was represented as log2 (fold to the GWSF basal level).

show abstract

GWSF-EuSWAP70 gene expression to enhance gray mold resistance in Arabidopsis thaliana

Huang,

Ma,

Cai

et al. 2024

Preprint

View full text Add to dashboard Cite

Background Eucalyptus, a widely cultivated woody plant, is susceptible to a diverse array of pests and diseases, leading to reduced yields and economic losses. Traditional breeding methods are very time-consuming; therefore, plant genetic engineering has emerged as a promising approach for plant pathogen management. However, the genetic transformation system of eucalyptus is still in its early stages of development, while studies on transgenic eucalyptus and its disease-resistance genes are limited. The SWAP70 gene has been shown to play a crucial role in the defense response of Arabidopsis thaliana and rice. In this study, the model plant A. thalianawas selected for genetic transformation. The aim was to enhance the expression of the EuSWAP70 gene derived from Eucalyptus grandis, and other disease-resistance genes, by utilizing an artificial GWSF promoter. Results The results showed that the EuSWAP70 gene was successfully transformed into A. thaliana, and the PCR assay confirmed the presence of the EuSWAP70 gene in transgenic Arabidopsis plants. The gray mold resistance of the EuSWAP70 transgenic Arabidopsis plants under GWSF and CaMV35S promoters was evaluated against Botrytis cinerea infection. After gray mold infection, Arabidopsisplants were ranked by leaf pore area percentage: wild-type > CaMV35S-EuSWAP70 > GWSF-EuSWAP70. The transgenic plants showed stronger gray mold resistance, and the GWSF-EuSWAP70 transgenic plants were stronger than the CaMV35S-EuSWAP70 transgenic plants. In two transgenic Arabidopsis plants treated with different inducers, the expression levels of ten disease-resistant genes were compared, and there was a significant difference between them. The expression levels of disease-resistance genes, particularly NPR1 and ChiB, were found to be higher in GWSF-EuSWAP70 transgenic Arabidopsis plants than those in CaMV35S-EuSWAP70transgenic plants. GWSF-EuSWAP70 transgenic Arabidopsis plants have stronger disease-resistance gene activity than CaMV35S-EuSWAP70plants under various inducers. The GWSF-EuSWAP70transgenic plants have minimal background expression and a wide range of plant inducer responses. Different inducer treatments had different effects on gene expression levels, B. cinerea treatment resulted in a significant increase in the expression levels of NPR1 and ChiB genes, whereas ethylene and salicylic acid (SA) pre-treatment reduced the expression levels of ChiB genes under B. cinerea treatment. Conclusions The EuSWAP70 gene can be effectively introduced into Arabidopsis plants, induced by two promoters, and potentially improve their B. cinerearesistance.

show abstract

Transcriptional properties of eight synthetic pathogen-inducible promoters in transgenic Arabidopsis thaliana

Cited by 4 publications

References 17 publications

Expression Activity of Artificial Promoters for Disease Resistance in Transgenic Eucalyptus urophylla

Expression Activity of Artificial Promoters for Disease Resistance in Transgenic Eucalyptus urophylla

Effect of virus inducible cis-element insertion on transcription properties of improved GWSF promoter in Arabidopsis thaliana

GWSF-EuSWAP70 gene expression to enhance gray mold resistance in Arabidopsis thaliana

Contact Info

Product

Resources

About