Effect of virus inducible cis-element insertion on transcription properties of improved GWSF promoter in Arabidopsis thaliana

Abstract

An ideal synthetic promoter can accurately regulate gene expression and the minimal cauliflower mosaic virus 35S promoter (GWSF) is an ideal synthetic pathogen-inducible promoter (SPIP) with several advantages. Three modified SPIPs, named as VGWSF, GWVSF, and GWSFV according to the arrangement of cis-elements, were optimized by inserting the dimer of a virus inducible cis-element (TTGGGAAGGAATTTCCTACT, V-box) upstream, midstream, or downstream the GWSF sequence. The three promoters were used to replace the cauliflower mosaic virus 35S promoter in the plasmid pBI121 in order to control the expression of the β-glucuronidase (gus) gene. Transformation of Arabidopsis thaliana (ecotype Col-0) plants was performed via the Agrobacterium tumefaciens strain GV3101 by the floral dip method. The five-week-old transgenic T3 lines were histochemically stained for GUS activity to evaluate the transcriptional properties of modified SPIPs. The VGWSF and GWVSF had low basal expressions and could not be induced by low or high temperatures and a low osmotic potential but could be induced by the tobacco mosaic virus (TMV). Although GWSFV had the highest GUS activity, it showed a substantial basal expression. After being treated with TMV, abscisic acid (ABA), salicylic acid (SA), or ethylene (Eth) for12 h, the expressions of modified SPIPs were evaluated by real-time quantitative PCR. With the basal expression of GWSF as a reference, each treatment was represented as log2 (fold to the GWSF basal level).

Expression Activity of Artificial Promoters for Disease Resistance in Transgenic Eucalyptus urophylla

“…Pathogen strains of Phytophthora capsici and Ralstonia solanacearum were purified and preserved in our laboratory. The TMV particles were prepared as described previously by Huang et al [ 9 ]. After the infected leaf discs were cultured in the dark on sterile filter paper saturated with a 1/2 MS liquid medium for 24 h, spore suspensions were evenly spread on the surface of the leaf discs at 50 μL 1 × 10 6 CFU (Colony-Forming Units) for Ralstonia solanacearum or Phytophthora , at 50 μL 2 mmol/L salicylic acid solution, or 50 μL extracts containing TMV particles.…”

“…To regulate precisely the expression of resistance genes in plant disease resistance genetic engineering, ideal promoters with a low basal expression, wide induction factors, and high induction efficiency are required. As a result, ideal promoters minimize side effects and improve resistance to pathogens quickly [ 9 ]. Natural promoters often lack expression intensity or expression specificity, so it is difficult to achieve transgenic disease resistance by using them [ 10 ].…”

Designing artificial synthetic promoters for accurate, smart, and versatile gene expression in plants

“…(2020) pro-SmAMP1 pro-SmAMP2 Stellaria media point mutation proline stress tobacco Efremova et al. (2020) VGWSF ; GWVSF ; GWSFV virus inducible cis -element GWSF insertion of v-box inducible pathogen inducible Arabidopsis Huang and Li (2020) pCaD EAS and EAH from hot pepper CRE deletion and combination induced by fungal and bacterial pathogens pathogen-inducible expression tobacco In et al. (2020) SynP14-SynP19 CREs from soybean, CaMV35S synthetic assemblies root specific, drought inducible root specific, drought inducible soybean hairy roots, Arabidopsis Jameel et al.…”