Tolerance of a Phage Element by Streptococcus pneumoniae Leads to a Fitness Defect during Colonization

Abstract

The pathogenesis of the disease caused by Streptococcus pneumoniae begins with colonization of the upper respiratory tract. Temperate phages have been identified in the genomes of up to 70% of clinical isolates. How these phages affect the bacterial host during colonization is unknown. Here, we examined a clinical isolate that carries a novel prophage element, designated Spn1, which was detected in both integrated and episomal forms. Surprisingly, both lytic and lysogenic Spn1 genes were expressed under routine growth conditions. Using a mouse model of asymptomatic colonization, we demonstrate that the Spn1 ؊ strain outcompeted the Spn1 ؉ strain >70-fold. To determine if Spn1 causes a fitness defect through a trans-acting factor, we constructed an Spn1؉ mutant that does not become an episome or express phage genes. This mutant competed equally with the Spn1 ؊ strain, indicating that expression of phage genes or phage lytic activity is required to confer this fitness defect. In vitro, we demonstrate that the presence of Spn1 correlated with a defect in LytA-mediated autolysis. Furthermore, the Spn1 ؉ strain displayed increased chain length and resistance to lysis by penicillin compared to the Spn ؊ strain, indicating that Spn1 alters the cell wall physiology of its host strain. We posit that these changes in cell wall physiology allow for tolerance of phage gene products and are responsible for the relative defect of the Spn1 ؉ strain during colonization. This study provides new insight into how bacteria and prophages interact and affect bacterial fitness in vivo.

Infant Mouse Model for the Study of Shedding and Transmission during Streptococcus pneumoniae Monoinfection

“…The template for the PCR was genomic DNA, obtained using a MasterPure DNA purification kit (Illumina), from strain P1397 (type 23F) (16), which contains a point mutation in rpsL. Resistant strains were selected on 5% sheep blood agar plates containing streptomycin (200 g/ml).…”

Sensing of Interleukin-1 Cytokines during Streptococcus pneumoniae Colonization Contributes to Macrophage Recruitment and Bacterial Clearance

“…For secondary challenge experiments, mice of the indicated genotype were colonized with WT S. pneumoniae and allowed 8 weeks to clear colonization. They were then recolonized with an isogenic strain containing a single point mutation that confers resistance to streptomycin and that has no colonization defect (21,22). All animal work was conducted in accordance with the guidelines provided by National Science Foundation Animal Welfare Requirements and the Public Health Service Policy on the Humane Care and Use of Laboratory Animals.…”

Phage-Derived Protein Induces Increased Platelet Activation and Is Associated with Mortality in Patients with Invasive Pneumococcal Disease

“…Experiments were performed in triplicate to determine the expression of pblB . Mitomycin C was included as a positive control, as it was previously shown to induce pblB expression (41). After 2 h of growth, pneumococci were harvested by centrifugation.…”

“…Residual DNA was removed with a DNase treatment using the Ambion Turbo DNA-free kit according to the manufacturer’s instructions (Ambion, Austin, TX). The qRT-PCR was performed as previously described by DeBardeleben et al (41) using the following primers: HBgyrAF, AATGAACGGGAACCCTTGGT, HBgyrAR, CCATCCCAACCGCGATAC, pblB_F, TACAGCTGTGAAAGCCTTGG, and pblB_R, GATAGCCATCTGGATTCTCAGG.…”