Three subsets of genes whose tissue specific expression is sex and age-dependent can be identified within the rat α2u-globulin family

Wang, Kathy S.; McFadyen, David A.; Locke, John; Hodgetts, Ross B.

doi:10.1002/(sici)1520-6408(1997)21:3<234::aid-dvg6>3.0.co;2-8

Cited by 8 publications

(10 citation statements)

References 18 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…These types can be distinguished by the presence of a single polymorphic site for each of the restriction enzymes SstI and VspI in exon 4, which is within the region amplified by the PCR primers KW1 and KW2 (see Fig. 1A; Wang et al 1997). Although the PCR products obtained with the primer pair KW1/KW2 were the same size (2000 bp) for all three P1 clones (p2860, p2861, and p2862), their products could be differentiated into three classes, designated N, V, or A, according to their restriction endonuclease profiles after digestion with the restriction enzymes SstI and VspI (Fig.…”

Section: Resultsmentioning

confidence: 99%

“…Since the various ␣ 2u -globulin genes are expressed in a tissue-specific, developmental, and hormonally regulated fashion, it is possible that the ␣ 2u -globulins possess a genomic organization that affects their regulation. We have previously identified three classes of ␣ 2u -globulin genes on the basis of polymorphisms for the restriction enzymes SstI and VspI (Wang et al 1997). Class N, which lacks both restriction sites, accounts for 57% (∼12/20) of the genes in the genome.…”

Section: Discussionmentioning

confidence: 99%

“…The three classes of genes are present in the genome in an approximately 4:2:1 (N:A:V) ratio (Wang et al 1997). One possibility suggested by that observation was that a cluster of 4 N class genes, 2 A class genes, and a V class gene served as a template (repeated three times) in the expansion to the present day ␣ 2u -globulin locus.…”

Section: Discussionmentioning

confidence: 99%

“…The primer pair KW1 (5Ј GATGTCTTG-GAGAATTCC 3Ј)/KW2 (5Ј CAATGATATTGTCCCTAGTG 3Ј; Wang et al 1997), generated from sequences in the second and fifth exons respectively (see Fig. 1A), were used in the PCR to amplify sequences from the P1 clones and NruI-digested rat genomic DNA fractionated on a pulsed field gel.…”

Section: P1 Clone Isolation and Characterizationmentioning

confidence: 99%

“…Unlike the hepatic synthesis of ␣ 2u -globulin, which is strictly male specific, several other tissues, in both sexes, express ␣ 2u -globulin genes. These tissues include salivary, lachrymal, preputial, perianal, meibomian, and mammary glands, kidney, and the brain (Laperche et al 1983;Gubits et al 1984;MacInnes et al 1986;Mancini et al 1989;Wang et al 1997).…”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

Genomic organization of the rat α 2u -globulin gene cluster

1999

Self Cite

View full text Add to dashboard Cite

The alpha 2u-globulin are a group of similar proteins, belonging to the lipocalin superfamily of proteins, that are synthesized in a subset of secretory tissues in rats. The many alpha 2u-globulin isoforms are encoded by a multigene family that exhibits extensive homology. Despite a high degree of sequence identity, individual family members show diverse expression patterns involving complex hormonal, tissue-specific, and developmental regulation. Analysis suggests that there are approximately 20 alpha 2u-globulin genes in the rat genome. We have used fluorescence in situ hybridization (FISH) to show that the alpha 2u-globulin genes are clustered at a single site on rat Chromosome (Chr) 5 (5q22-24). Southern blots of rat genomic DNA separated by pulsed field gel electrophoresis indicated that the alpha 2u-globulin genes are contained on two NruI fragments with a total size of 880 kbp. Analysis of three P1 clones containing alpha 2u-globulin genes indicated that the alpha 2u-globulin genes are tandemly arranged in a head-to-tail fashion. The organization of the alpha 2u-globulin genes in the rat as a tandem array of single genes differs from the homologous major urinary protein genes in the mouse, which are organized as tandem arrays of divergently oriented gene pairs. The structure of these gene clusters may have consequences for the proposed function, as a pheromone transporter, for the protein products encoded by these genes.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Section: P1 Clone Isolation and Characterizationmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Genomic organization of the rat α 2u -globulin gene cluster

1999

Self Cite

View full text Add to dashboard Cite

show abstract

High-resolution FISH mapping of the rat α 2u -globulin multigene family

McFadyen

Locke

2000

Mammalian Genome

View full text Add to dashboard Cite

The rat alpha2u-globulins are a group of similar proteins that are encoded by a family of approximately 20 genes located a single locus of < or =880 kbp on Chromosome (Chr) 5q. Individual members of this gene family demonstrate complex tissue, hormonal, and developmental expression patterns despite a high degree of sequence similarity among the members and consequently provide an interesting system for studying the evolution of differential gene expression. Hybridization analysis indicated that gene classes, similar to those identified at the homologous MUP locus in the mouse, do not exist within the rat alpha2u-globulin locus. Furthermore, cross-hybridization analysis revealed the presence of conserved sequences in the 5' and 3' regions flanking the alpha2u-globulin genes, some of which were present in an inverted orientation. We have used high-resolution fiber FISH to examine the structural organization of the alpha2u-globulin locus, and found the genes to be arranged as an array of both direct and inverted repeats. The organization of the rat alpha2u-globulin genes differs from the MUP genes and suggests different evolutionary events have reorganized these homologous sets of genes.

show abstract

PARP-1 Val762Ala polymorphism, CagA+ H. pylori infection and risk for gastric cancer in Han Chinese population

Zhang

et al. 2008

Mol Biol Rep

View full text Add to dashboard Cite

show abstract

Three subsets of genes whose tissue specific expression is sex and age-dependent can be identified within the rat α2u-globulin family

Cited by 8 publications

References 18 publications

Genomic organization of the rat α 2u -globulin gene cluster

Genomic organization of the rat α 2u -globulin gene cluster

High-resolution FISH mapping of the rat α 2u -globulin multigene family

PARP-1 Val762Ala polymorphism, CagA+ H. pylori infection and risk for gastric cancer in Han Chinese population

Contact Info

Product

Resources

About