The Zipper Region of Epstein-Barr Virus bZIP Transcription Factor Zta Is Necessary but Not Sufficient To Direct DNA Binding

Hicks, Matthew R.; Al-Mehairi, Salama; Sinclair, Alison J.

doi:10.1128/jvi.77.14.8173-8177.2003

Cited by 21 publications

(30 citation statements)

References 35 publications

(31 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Alignment of the carboxyl-terminal 72 aa of BZLF1 (aa 173-245) and rhBZLF1 (aa 176 -247) proteins shows 84% sequence homology (overall BZLF1 homology is 71%). This region contains the DNA contact and multimerization domains (aa 175-195 and 196 -245 of the BZLF1 protein, respectively), and all residues appear to be important for the DNA binding-dependent functions of BZLF1 (36). Due to the importance of these residues and sequence conservation between different rhLCVs, sequence variation is probably constrained by functional requirements, preventing the acquisition of mutations in this region.…”

Section: Discussionmentioning

confidence: 99%

The BZLF1 Homolog of an Epstein-Barr-Related γ-Herpesvirus Is a Frequent Target of the CTL Response in Persistently Infected Rhesus Macaques

Fogg

Garry

Awad

et al. 2006

The Journal of Immunology

View full text Add to dashboard Cite

Although CD8+ T lymphocytes targeting lytic infection proteins dominate the immune response to acute and persistent EBV infection, their role in immune control of EBV replication is not known. Rhesus lymphocryptovirus (rhLCV) is a γ-herpesvirus closely related to EBV, which establishes persistent infection in rhesus macaques. In this study, we investigated cellular immune responses to the rhLCV BZLF1 (rhBZLF1) homolog in a cohort of rhLCV-seropositive rhesus macaques. rhBZLF1-specific IFN-γ ELISPOT responses ranging between 56 and 3070 spot-forming cells/106 PBMC were detected in 36 of 57 (63%) rhesus macaques and were largely mediated by CD8+ T lymphocytes. The prevalence and magnitude of ELISPOT responses were greater in adult (5–15 years of age) rather than juvenile macaques (<5 years of age), suggesting that rhBZLF1-specific CTL increase over time following early primary infection. A highly immunogenic region in the carboxyl terminus of the rhBZLF1 protein containing overlapping CTL epitopes restricted by Mamu-A*01 and other as yet unidentified MHC class I alleles was identified. The presence of a robust CD8+ T lymphocyte response targeting this lytic infection protein in both rhesus macaques and humans suggests that these CTL may be important for immune control of EBV-related γ-herpesvirus infection. These data underscore the utility of the rhLCV-macaque model for studies of EBV pathogenesis.

show abstract

Section: Discussionmentioning

confidence: 99%

The BZLF1 Homolog of an Epstein-Barr-Related γ-Herpesvirus Is a Frequent Target of the CTL Response in Persistently Infected Rhesus Macaques

Fogg

Garry

Awad

et al. 2006

The Journal of Immunology

View full text Add to dashboard Cite

show abstract

“…The results obtained are summarized by a histogram (Fig. 5F), showing no signifi- [ 35 S]methionine-labeled Zta, Zta C189S, Zta C222S, and Zta H199ter were generated in an in vitro translation (IVT) system (13). The ability of each protein to form dimers was assessed following cross-linking with 0.007% glutaraldehyde (as described in reference 33), followed by separation on SDS-PAGE and signal detection using a phosphorimager.…”

mentioning

confidence: 99%

“…The ability of the proteins to bind DNA was assessed using EMSA (C). The targets are indicated above each section (probe) and are double-stranded versions of the following ZREs, each containing a single ZRE: "AP1" (13), "AP1 mut" (GATCCACCCCTTAGAGGAAAAC ATACG), "ZRE" (R-promoter-distal site; AGCTTATGAGCGATTTTAT) (28), and OriLyt (12) Here we provide further evidence that amino acids in the basic region of the EBV lytic cycle switch protein Zta are required to reactivate EBV from latency. Specifically, we show that C189 is essential for this function of Zta.…”

mentioning

confidence: 99%

Mutation of a Single Amino Acid Residue in the Basic Region of the Epstein-Barr Virus (EBV) Lytic Cycle Switch Protein Zta (BZLF1) Prevents Reactivation of EBV from Latency

Schelcher

Valencia

Delecluse

et al. 2005

J Virol

Self Cite

View full text Add to dashboard Cite

Zta, the product of the BZLF1 gene carried by Epstein-Barr virus (EBV), is crucial for reactivation of EBV from latency. Zta is a member of the bZIP family of transcription factors, and in common with many of these, Zta possesses a conserved cysteine residue in its basic region (C189) and a further cysteine residue in its ZIP region (C222). We demonstrate that C189 is required to reactivate EBV from latency but C222 is not and that this single amino acid affects two independent functions of Zta, (i) binding to a Zta-responsive site and (ii) manipulating the cell cycle.

show abstract

“…Vectors used for the in vitro translation of Zta and expression in eukaryotic cells have been described previously (16,44,51).…”

Section: Methodsmentioning

confidence: 99%

Functional Interaction between Epstein-Barr Virus Replication Protein Zta and Host DNA Damage Response Protein 53BP1

Bailey¹,

Verrall²,

Schelcher³

et al. 2009

J Virol

Self Cite

View full text Add to dashboard Cite

Epstein-Barr virus (EBV; human herpesvirus 4) poses major clinical problems worldwide. Following primary infection, EBV enters a form of long-lived latency in B lymphocytes, expressing few viral genes, and itpersists for the lifetime of the host with sporadic bursts of viral replication. The switch between latency and replication is governed by the action of a multifunctional viral protein Zta (also called BZLF1, ZEBRA, and Z). Using a global proteomic approach, we identified a host DNA damage repair protein that specifically interacts with Zta: 53BP1. 53BP1 is intimately connected with the ATM signal transduction pathway, which is activated during EBV replication. The interaction of 53BP1 with Zta requires the C-terminal ends of both proteins. A series of Zta mutants that show a wild-type ability to perform basic functions of Zta, such as dimer formation, interaction with DNA, and the transactivation of viral genes, were shown to have lost the ability to induce the viral lytic cycle. Each of these mutants also is compromised in the C-terminal region for interaction with 53BP1. In addition, the knockdown of 53BP1 expression reduced viral replication, suggesting that the association between Zta and 53BP1 is involved in the viral replication cycle.The Epstein-Barr virus (EBV) life cycle is divided temporally into two phases, latency and the lytic cycle. Following the infection of epithelial cells of the oropharynx, EBV enters the lytic cycle, where the expression of approximately 80 genes and numerous rounds of genome replication occur, culminating in the production of infectious virions. The infection of B lymphocytes results in the establishment of viral latency with a restricted gene expression pattern; these cells sporadically enter the lytic cycle and reproduce infectious virus (27,53).The EBV gene BZLF1 has been associated specifically with the disruption of latency (reviewed in references 34 and 50). This gene encodes the protein Zta (ZEBRA, BZLF1, Z), which has an undisputed role in activating the viral lytic cycle. Not only is the enforced expression of Zta in cells harboring the latent virus able to induce the viral lytic cycle, but a mutant virus where BZLF1 has been inactivated also is unable to replicate the viral genome (10). Zta has homology to the bZIP family of transcription factors whose general structure includes a transactivation domain and a bZIP domain consisting of a basic DNA contact region and a coiled-coil dimerization motif, termed a leucine zipper (24,49,50). Zta has a more complex dimerization domain than other bZIP family members, consisting of a dimeric leucine zipper entwined with an adjacent carboxyl-terminal region (35,38,44,50). Zta is multifunctional; through its basic region, it interacts with specific sequence DNA motifs (ZREs) that occur in the promoters of several viral and cellular genes (49) and in the viral origin of lytic replication (Ori-lyt) (46,47). Through its bZIP domain, Zta interacts with cellular transcription factors such as p53, RAR, NF-B, CBP, and C/EBP␣ (7), ...

show abstract

The Zipper Region of Epstein-Barr Virus bZIP Transcription Factor Zta Is Necessary but Not Sufficient To Direct DNA Binding

Cited by 21 publications

References 35 publications

The BZLF1 Homolog of an Epstein-Barr-Related γ-Herpesvirus Is a Frequent Target of the CTL Response in Persistently Infected Rhesus Macaques

The BZLF1 Homolog of an Epstein-Barr-Related γ-Herpesvirus Is a Frequent Target of the CTL Response in Persistently Infected Rhesus Macaques

Mutation of a Single Amino Acid Residue in the Basic Region of the Epstein-Barr Virus (EBV) Lytic Cycle Switch Protein Zta (BZLF1) Prevents Reactivation of EBV from Latency

Functional Interaction between Epstein-Barr Virus Replication Protein Zta and Host DNA Damage Response Protein 53BP1

Contact Info

Product

Resources

About