The use of PCR and Real-Time PCR for Qualitative and Quantitative Determination of Poultry and Chicken Meals

Natonek-Wiśniewska, Małgorzata; Krzyscin, P.

doi:10.1515/aoas-2016-0003

Cited by 4 publications

(5 citation statements)

References 25 publications

(1 reference statement)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Considering the importance of precise pet food labelling, especially for animals with mild or life-threatening allergies, accurate detection of mislabeled or undeclared animal species is important for the safety of pets [23]. What is more, large variation among commercially available diets marketed for support the treatment of various medical conditions, such as skin and coat health or allergies, may cause confusion for caregivers during diet selection [26]. One of the problems with pet food mislabeling is the ingredient listing itself.…”

Section: Discussionmentioning

confidence: 99%

“…where: m 1 -weight of first repeat of sample; c 1 -the concentration of DNA obtained from it; Determination of the amount of chicken DNA was performed at Step One Plus ™ Real-Time PCR v2.3 (Thermo Fisher Scientific, MA USA). Primers complementary to the fragment encoding 16 SrRNA in chickens and TaqMan ® MGB (minor groove binder, Thermo Fisher Scientific, MA USA) probes were used, described in detail by Natonek-Wiśniewska and Krzyścin [26]. The thermal program included 40 cycles and its annealing temperature was 60 °C.…”

Section: Dna Identificationmentioning

confidence: 99%

See 1 more Smart Citation

Detection of chicken DNA in commercial dog foods

et al. 2022

Self Cite

View full text Add to dashboard Cite

Background These days the number of potential food allergens is very large, but chicken is one of the most common allergens in dogs. Elimination diet is one of the clinical tools for the diagnosis of allergies and allergy tests are not very reliable. The restriction diet is most commonly carried out by feeding pet foods, relying on the ingredients on the label to select an elimination diet not containing previously eaten foods. Unfortunately, mislabeling of pet food is quite common. The purpose of this study was to determine the absence or presence of chicken DNA using both qualitative and quantitative polymerase chain reaction (PCR) analysis methods in dry and wet maintenance complete pet foods for adult dogs. Results were used to verify the declared composition on the labels. Results Eleven out of fifteen (73%) dog foods were produced as declared by the manufacturer, two of which showed the presence of chicken protein as stated on the label. The remaining nine foods contained amounts of chicken DNA below 1%, consistent with declarations that no chicken was added in the composition. Four of tested dog foods (27%) were not produced consistently with the declaration on the packaging. Two dog foods (one dry and one wet) did not contain the claimed chicken protein. In two foods the addition of chicken DNA was detected at the level of over 2% and almost 6%, respectively. Conclusions In this study, we focused on one of the most commonly undeclared animal species on the label—chicken protein—and performed DNA analyzes to investigate possible contamination and mislabeling. The results showed some inaccuracies. However, most of them are trace amounts below 1%, which proves compliance with the label. Our results showed that undeclared animal species can be as common as missing an animal protein declared on the label. The conducted research indicates that both dry and wet analyzed foods should not be recommended as a diagnostic tool in elimination tests, because it may result in false negative results. Over-the-counter maintenance foods for dogs should not be recommended for the diagnosis and treatment of food hypersensitivity.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Dna Identificationmentioning

confidence: 99%

Detection of chicken DNA in commercial dog foods

et al. 2022

Self Cite

View full text Add to dashboard Cite

show abstract

“…A qualitative analysis was performed on Veriti Thermal Cycler (Applied Biosystems, Foster City, CA, USA) according to the PCR method proposed by Natonek‐Wiśniewska, Krzyścin, and Piestrzyńska‐Kajtoch (), using dried chicken meat as a positive control (PTC) and water as a negative control (NTC). In the quantitative analysis, the qPCR technology was used, described in detail in Natonek‐Wiśniewska and Krzyścin ().…”

Section: Methodsmentioning

confidence: 99%

“…In the PCR analysis, the following starters were used: F: 5′‐ AACCTCCTCCAGCGGATAATAAT; R: 5′‐ TTTGTTGGTGGCTGCTTGAA (Natonek‐Wiśniewska et al., ). Additionally, P: 5′‐ CCCTCCCCGCACTG, a minor groove binding (MGB) oligoprobe, was used in the quantitative analysis (Natonek‐Wiśniewska & Krzyścin, ).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Qualitative and quantitative detection of chicken deoxyribonucleic acid (DNA) in dry dog foods

Holda

Natonek-Wiśniewska

Krzyscin

et al. 2018

Animal Physiology Nutrition

View full text Add to dashboard Cite

Chicken is a common protein source in pet foods and is concurrently listed among food allergens. Commercial over-the-counter (OTC) diets with an alternative animal protein source are considered suitable for dietary elimination trials by pet owners. The potential presence of undeclared chicken-derived ingredients in these diets can compromise the outcome of the trial during the diagnosis of adverse food reactions. The aim of this study was to selectively verify the absence or presence of chicken DNA in 10 OTC dry canine foods, using qualitative and quantitative approaches. The method of identification of chicken-derived protein was elaborated with the polymerase chain reaction (PCR) technology, whereas quantitative real-time PCR was used for the quantitative assessment. In most of the analysed samples, the chicken DNA was detectable; however, the quantified amounts were predominantly low, although differences between batches were observed.

show abstract