The Role of Cytokinin During Infection ofArabidopsis thalianaby the Cyst NematodeHeterodera schachtii

Abstract

Plant-parasitic cyst nematodes induce the formation of hypermetabolic feeding sites, termed syncytia, as their sole source of nutrients. The formation of the syncytium is orchestrated by the nematode, in part, by modulation of phytohormone responses, including cytokinin. In response to infection by the nematode Heterodera schachtii, cytokinin signaling is transiently induced at the site of infection and in the developing syncytium. Arabidopsis lines with reduced cytokinin sensitivity show reduced susceptibility to nematode infection, indicating that cytokinin signaling is required for optimal nematode development. Furthermore, lines with increased cytokinin sensitivity also exhibit reduced nematode susceptibility. To ascertain why cytokinin hypersensitivity reduces nematode parasitism, we examined the transcriptomes in wild type and a cytokinin-hypersensitive type-A arr Arabidopsis mutant in response to H. schachtii infection. Genes involved in the response to biotic stress and defense response were elevated in the type-A arr mutant in the absence of nematodes and were hyperinduced following H. schachtii infection, which suggests that the Arabidopsis type-A arr mutants impede nematode development because they are primed to respond to pathogen infection. These results suggest that cytokinin signaling is required for optimal H. schachtii parasitism of Arabidopsis but that elevated cytokinin signaling triggers a heightened immune response to nematode infection.

Should I fight or should I grow now? The role of cytokinins in plant growth and immunity and in the growth–defence trade-off

“…In rice, treatment of plants with high levels of cytokinins led to increased defence gene expression against the biotrophic rice blast fungus Magnaporthe oryzae (Jiang et al, 2013). Added to other reports from the literature where high levels of cytokinins in plants have been linked to resistance to viruses (Clarke et al, 2000;Pogany et al, 2004) and even nematodes (Shanks et al, 2016), these data point to a role for cytokinins in activating defence responses and contributing to physiological conditions that help contain invading biotrophic pathogens, a process we have now named cytokinin-induced immunity.…”

Cytokinin Regulates the Etioplast-Chloroplast Transition through the Two-Component Signaling System and Activation of Chloroplast-Related Genes

“…The ARR12 construct was generated by cloning a genomic DNA fragment of ARR12 into the vector pEarlyGate 203 (Early et al, 2006), using primers ATGACTGTTGAACAAAATTTA GAA and TATGCATGTTCTGAGTGAACT for initial amplification of ARR12. The ARR10 construct has been described (Shanks et al, 2016). Seedlings were grown on vertical plates with 13 MS media with vitamins and 1% (w/v) Suc for 3 weeks under 50-mE light intensity, and then treated with 5 mM BA in liquid MS media for 30 min.…”

Canonical and noncanonical ethylene signaling pathways that regulate Arabidopsis susceptibility to the cyst nematode Heterodera schachtii

“…Additional support for noncanonical signaling is that only the loss of ETR1 affects this trait, whereas loss of the other receptor isoforms or CTR1 have no noticeable effect; this is a result not predicted by current models of ethylene signaling where all receptors signal through CTR1 during plant–nematode interactions. Because auxin and cytokinin are involved in responses to H. schachtii (Grunewald et al ., ; Hewezi et al ., ; Shanks et al ., ; Siddique et al ., ), we tested whether or not ETR1‐mediated Arabidopsis susceptibility to H. schachtii was through its interaction with auxin and/or cytokinin. To do this, we determined nematode susceptibility of etr1‐6;etr2‐3;ein4‐4 , E666A, Q881A and Col‐0 plants treated with IAA, NNPA (auxin transport inhibitor), BAP (synthetic cytokinin) or lovastatin (cytokinin biosynthesis inhibitor).…”

“…c) suggests repression function of ETR1 on these negative regulators of cytokinin signaling, presumably to activate cytokinin response genes, leading to successful nematode parasitism. This is in agreement with recent studies showing transient induction of cytokinin signaling at H. schachtii infection sites in Arabidopsis (Shanks et al ., ; Siddique et al ., ), and functional links between ETR1 and components of the cytokinin pathway (Binder et al ., ). The importance of cytokinin for nematode feeding site formation and development has been demonstrated using numerous cytokinin signaling mutants (Shanks et al ., ; Siddique et al ., ).…”