The role for the exocyst complex subunits Exo70B2 and Exo70H1 in the plant–pathogen interaction

Abstract

Recently, the octameric vesicle-tethering complex exocyst was found in plants and its importance for Arabidopsis morphogenesis was demonstrated. Exo70 exocyst subunits in plants, unlike in yeasts and mammals, are represented by a multigene family, comprising 23 members in Arabidopsis. For Exo70B2 and Exo70H1 paralogues, transcriptional up-regulation was confirmed on treatment with an elicitor peptide, elf18, derived from the bacterial elongation factor. Their ability to participate in the exocyst complex formation was inferred by the interaction of both the Exo70s with several other exocyst subunits using the yeast two-hybrid system. Arabidopsis plants mutated in these two genes were used to analyse their local reaction upon inoculation with Pseudomonas syringae pv. maculicola and the fungal pathogen Blumeria graminis f. sp. hordei. The Pseudomonas sensitivity test revealed enhanced susceptibility for the two exo70B2 and one H1 mutant lines. After Blumeria inoculation, an increase in the proportion of abnormal papilla formation, with an unusual wide halo made of vesicle-like structures, was found in exo70B2 mutants. Intracellular localization of both Exo70 proteins was studied following a GFP fusion assay and Agrobacterium-mediated transient expression of the constructs in Nicotiana benthamiana leaf epidermis. GFP-Exo70H1 localizes in the vesicle-like structures, while GFP-Exo70B2 is localized mainly in the cytoplasm. It is concluded that both Exo70B2 and Exo70H1 are involved in the response to pathogens, with Exo70B2 having a more important role in cell wall apposition formation related to plant defence.

The Ubiquitin Ligase PUB22 Targets a Subunit of the Exocyst Complex Required for PAMP-Triggered Responses in Arabidopsis

“…We also confirmed via Y2H that the full-length PUB22 was able to interact with the full-length Exo70B2 (see Supplemental Figures 1B and 1C online). Exo70B2 also interacts with other subunits of the exocyst complex, supporting its role as a functional component of the exocyst complex (Pecenková et al, 2011).…”

“…This expansion suggests that plants have evolved functionally specialized Exo70 genes (Zárský et al, 2009). Accordingly, a recent report demonstrated that Arabidopsis Exo70B2 and Exo70H1 genes are induced in response to pathogens and PAMPS and are genetically necessary for a functional immune response (Pecenková et al, 2011).…”

The RING-Type E3 Ligase XBAT35.2 Is Involved in Cell Death Induction and Pathogen Response

“…In plants, PRA1s have been linked to vesicle trafficking and fusion (Heo et al, 2010;Lee et al, 2011). However, similar to ACD11 and XBAT35.2, the interacting AtPRA1.Fs may be involved in plant immunity as components of the vesicletrafficking system are actively engage in mounting defense against pathogens (Frei dit Frey and Robatzek, 2009;Nomura et al, 2011, Pecenková et al, 2011Stegmann et al, 2012). Although the significance of the interaction between AtPRA1.Fs, XBAT35.2, and ACD11 needs to be explored, the interaction provides further support for the Golgi localization of XBAT35.2.…”

Cell Wall Maturation of Arabidopsis Trichomes Is Dependent on Exocyst Subunit EXO70H4 and Involves Callose Deposition

“…We used the Matchmaker GAL4 Two-Hybrid System 3 (Clontech) following the manufacturer's instructions. We used constructs prepared by Hála et al (2008), Fendrych et al (2010, and Pecenková et al (2011), and EXO70H4 cds was amplified from genomic DNA and subcloned into the pGBKT7 vector between NcoI and SalI using these primers: For_EXO70H4_NcoI, TTTCCATGGTGACGAGAAAAGCAATGAT; and Rev_EXO70H4_SalI, TTTGTCGACTTAGGACATGGATTGCCTTGAC. From this vector, EXO70H4 cds was recloned into pGADT7 using NdeI and XhoI restriction sites.…”