The nucleotide sequence of the gB glycoprotein gene of HSV-2 and comparison with the corresponding gene of HSV-1

Bzik, David J.; DebRoy, Chitrita; Fox, Barbara A.; Pederson, Nels E.; Person, Stanley

doi:10.1016/0042-6822(86)90196-0

Cited by 87 publications

(64 citation statements)

References 44 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…within the 5' transcribed, non-coding sequence, between nucleotides 107 and 117 5' to the translation initiation site of the gB gene. It is noteworthy that the HSV-2 gB lacks several of the amino acids in the signal sequence, an observation also reported by others (Bzik et al, 1986;Stuve et al, 1987). The 3' crossover site was mapped to the sequence ACGCACATCAAGGTGGGCCAGCCGCAGTACTAC, shown by large bold letters in row R and shared by both HSV-1 and HSV-2 gB.…”

Section: Discussionsupporting

confidence: 53%

“…Previous reports have shown that HSV-I (Bzik et al, 1984;Pellett et al, 1985) and HSV-2 (Bzik et al, 1986;Stuve et al, 1987) gB genes are homologous but diverge at the 5' terminus. Insofar as HSV-1-and HSV-2-specific monoclonal antibodies to gB neutralize virus, each gene encodes both type-specific and type-common epitopes (Chapsal & Pereira, 1988;Pereira et al, 1981Pereira et al, , 1982.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

A Subset of Type-specific Epitopes Map in the Amino Terminus of Herpes Simplex Virus Type 1 Glycoprotein B

Kousoulas

Arsenakis

Pereira

1989

Journal of General Virology

View full text Add to dashboard Cite

SUMMARYWe constructed a recombinant herpes simplex virus (HSV) containing the transcribed coding and non-coding sequences of HSV-1 strain F glycoprotein B (gB) gene, a 71 gene, fused to the promoter-regulatory sequences of the HSV-1 g4 gene and inserted into the thymidine kinase gene of RH1G44, an HSV-1 × HSV-2 recombinant that contains an HSV-2 gB gene at the natural locus. Phenotypic analyses of the insertion mutant, R3145, showed that the ~gB gene was transcribed in the presence of cycloheximide but underwent partial conversion to the HSV-2 form. Nucleotide sequencing of the gene indicated that the 5' crossover occurred between nucleotides 107 and 117 upstream from the translation initiation site and that the 3' crossover occurred between the sequences specifying amino acids 402 and 412 of the HSV-1 gB. The chimeric protein consisted of an N-terminal 405 to 415 amino acids encoded by the HSV-2 gene and a C-terminal 462 to 472 amino acids encoded by the HSV-1 gene.Comparison of the reactivity of the parental and recombinant gB with type-specific monoclonal antibodies indicated that the chimeric gB lost reactivity with four HSV-1-specific antibodies but gained reactivity with three HSV-2-specific antibodies.

show abstract

Section: Discussionsupporting

confidence: 53%

Section: Discussionmentioning

confidence: 99%

A Subset of Type-specific Epitopes Map in the Amino Terminus of Herpes Simplex Virus Type 1 Glycoprotein B

Kousoulas

Arsenakis

Pereira

1989

Journal of General Virology

View full text Add to dashboard Cite

show abstract

“…Fine structure mapping of the 5' terminus of the gB mRNA by S1 nuclease and primer extension analysis located a single start site for transcription at either nucleotide 831 or 834. The base sequence preceding nucleotide 831 has a match of seven in nine to the proposed HSV-1 gB mRNA start site (Bzik et al, 1986). The first downstream AUG codon occurs at position 951 which agrees with the predicted start site of the EHV-1 gB gene (Whalley et al, 1989).…”

Section: Virus Neutralization Testsupporting

confidence: 53%

Transcript Analysis of The Equine Herpesvirus 1 Glycoprotein B Gene Homologue and Its Expression by a Recombinant Vaccinia Virus

Bell

Boyle

Whalley

1990

Journal of General Virology

View full text Add to dashboard Cite

“…However, the glycoproteins of HSV-2 have not been studied as extensively. The kinetics of synthesis of gB-2, gC-2, gD-2, gE-2 and gG-2 proteins have been studied in virus-infected cells (Balachandran et al, 1982) and the sequences of the genes encoding gB-2 (Bzik et al, 1986), gC-2 (Swain et al, 1985) and gD-2 (Watson, 1983) have recently been determined.…”

Section: Introductionmentioning

confidence: 99%

Herpes Simplex Virus Type 2 Glycoprotein Biogenesis: Effect of Monensin on Glycoprotein Maturation, Intracellular Transport and Virus Infectivity

Ghosh‐Choudhury

Graham

Ghosh

1987

Journal of General Virology

View full text Add to dashboard Cite

SUMMARYThe ionophore monensin inhibited the formation of herpes simplex virus type 2 (HSV-2) particles by about 30~ but the yields of infectious particles were reduced to 5~ and 1 ~ for cell-associated and extracellular virus, respectively. The presence of monensin did not affect the processing of the two viral glycoproteins gB-2 and gG-2. However, two other glycoproteins, gC-2 and gD-2, were not processed to their fully mature forms in the monensin-treated cells and only the faster moving pgC-2 and pgD-2 were detected. The cell-associated virus particles contained the glycoproteins gB-2, gC-2, gD-2 and gG-2, whereas the extracellular virus particles contained only gG-2 glycoprotein. These results suggest that HSV

show abstract

The nucleotide sequence of the gB glycoprotein gene of HSV-2 and comparison with the corresponding gene of HSV-1

Cited by 87 publications

References 44 publications

A Subset of Type-specific Epitopes Map in the Amino Terminus of Herpes Simplex Virus Type 1 Glycoprotein B

A Subset of Type-specific Epitopes Map in the Amino Terminus of Herpes Simplex Virus Type 1 Glycoprotein B

Transcript Analysis of The Equine Herpesvirus 1 Glycoprotein B Gene Homologue and Its Expression by a Recombinant Vaccinia Virus

Herpes Simplex Virus Type 2 Glycoprotein Biogenesis: Effect of Monensin on Glycoprotein Maturation, Intracellular Transport and Virus Infectivity

Contact Info

Product

Resources

About