The mosaic structure of the symbiotic plasmid of Rhizobium etliCFN42 and its relation to other symbiotic genome compartments

Abstract

Correspondence: Guillermo Dávila. E-mail: davila@cifn.unam.mx. © 2003 González et al.; licensee BioMed CentralLtd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL. The mosaic structure of the symbiotic plasmid of Rhizobium etli CFN42 and its relation to other symbiotic genome compartments The symbiotic plasmid is a circular molecule of 371,255 base-pairs containing 359 coding sequences. Nodulation and nitrogen-fixation genes common to other rhizobia are clustered in a region of 125 kilobases. Numerous sequences related to mobile elements are scattered throughout. In some cases the mobile elements flank blocks of functionally related sequences, thereby suggesting a role in transposition. The plasmid contains 12 reiterated DNA families that are likely to participate in genomic rearrangements. Comparisons between this plasmid and complete rhizobial genomes and symbiotic compartments already sequenced show a general lack of synteny and colinearity, with the exception of some transcriptional units. There are only 20 symbiotic genes that are shared by all SGCs. AbstractBackground: Symbiotic bacteria known as rhizobia interact with the roots of legumes and induce the formation of nitrogen-fixing nodules. In rhizobia, essential genes for symbiosis are compartmentalized either in symbiotic plasmids or in chromosomal symbiotic islands. To understand the structure and evolution of the symbiotic genome compartments (SGCs), it is necessary to analyze their common genetic content and organization as well as to study their differences. To date, five SGCs belonging to distinct species of rhizobia have been entirely sequenced. We report the complete sequence of the symbiotic plasmid of Rhizobium etli CFN42, a microsymbiont of beans, and a comparison with other SGC sequences available.

The partitioned Rhizobium etli genome: Genetic and metabolic redundancy in seven interacting replicons

“…Previously, we reported that p42d (pSym) contains most of the genes needed for symbiosis (10). Here, we identify homologs for nodulation genes in other replicons of the genome.…”

“…Genomic comparisons among the three Rhizobiacea R. etli, S. meliloti, and A. tumefaciens indicate that 23.3% of the combined set of proteins (10,877) are shared by the three species, an extra 14.4% are present in only two of three, and the rest are unique to each compared species, namely 18%, 21%, and 16%, respectively (Fig. 2).…”

Identification of Functional mob Regions in Rhizobium etli : Evidence for Self-Transmissibility of the Symbiotic Plasmid pRetCFN42d

“…PCR primers Yp028F and Yp028R were designed to match conserved regions of yp028 gene of pRetCFN42d of R. etli (NC004041). The primer sequences of Yp028F (GGATCCTCCATCACGTTGAGCAGC) and Yp028R (GGATCCGGCATCAACCTCTGAGAC) correspond to positions 140473 to 140490 and 141118 to 141135, respectively, of the R. etli pRetCFN42d replicon sequence (19), with BamHI restriction sites at the 5Ј end of the primers (underlined) to facilitate subsequent clonings. These primers were used at a final concentration of 50 pmol in 50-l amplification reactions containing 1ϫ PCR buffer, 200 M deoxynucleoside triphosphates, 1.5 mM MgCl 2 , and 1 U of Taq polymerase (Sigma).…”

“…Two primers, RetraA⌬F (TCGTTGGTGTGGGCGAGCA) and RetraA⌬R (GCGCAGCCG CCGATGCTCA), were used to amplify a 2,489-bp fragment from the R. etli CE3 pSym (from positions 143900 to 146388 of accession number NC004041 [19]). The PCR product was cloned into pGEM-T Easy cloning vector; a 673-bp EcoRV fragment from traA was removed and replaced by a Gm resistance (Gm r ) gene cassette from SmaI-digested pMS255 (3).…”

“…However, genome sequencing is revealing that many of these elements do carry genes potentially involved in conjugal transfer (18,19,30,31). Therefore, it seems necessary to investigate whether pSym plasmids that do not transfer at appreciable rates in the laboratory are actually proficient for self-transmissibility under natural conditions.…”