The importance of and a method for including transfection efficiency into real‐time PCR data analyses

Abstract

The polymerase chain reaction (PCR) is widely used to ascertain absolute or relative changes in the expression levels of specific genes as a function of cell type or in response to changes in environmental stimuli. Real-time PCR is an advance which allows for the analysis of gene expression over a wide range of initial cDNA concentrations, where the cDNA is the product of reverse transcriptase reactions applied to RNA samples. With the advent and advances in gene delivery technologies, it is now common for the cellular responses under scrutiny to be initiated via the expression of an exogenously delivered gene. When transfection (or transduction) is a part of the procedure used to prepare cell samples for real-time PCR, it is necessary to take the efficiency of gene delivery into account. Here a robust mathematical model for such analyses is derived, and validated with theoretical and experimental support. Comparison to existing analysis methods is presented to demonstrate the high significance of noting transfection, loading, and primer PCR efficiencies when processing PCR data.

Neuroanatomical characterization of a growth hormone secretagogue receptor‐green fluorescent protein reporter mouse

“…The ABI 7300 Real‐time PCR System (Applied Biosystems, Foster City, CA) was used to determine the mRNA expression level for the genes of interest. Previously designed and validated primers were used: mGHSR forward 5′‐ACCGTGATGGTATGGGTGTCG‐3′, reverse 5′‐CACAGTGAGGCAGAAGACCG‐3′ (Chuang et al, ); eGFP forward 5′‐ATCATGGCCGACAAGCAGAAGAAC‐3′, reverse 5′‐GTACAGCTCGTCCATGCCGAGAGT (Godbey et al, ); and cyclophilin forward 5‐TGGAGAGCACCAAGACAGACA‐3′, reverse 5′‐TGCCGGAGTCGACAATGAT‐3′ (Sakata et al, ).…”

Intracellular Delivery and Triggered Release of DNA Using Biodegradable Poly(2‐hydroxypropylene imine)s Containing Cystamine Units

“…Transfected cells are often used for gene expression analysis by RT‐PCR . Obtaining a maximum transfection efficiency is one of the keys to successful transgene expression and the simple way to achieve that is transfecting the cells twice .…”

Characterisation of major vault protein during the life cycle of the human parasite Schistosoma mansoni

“…Normality of the data was established using one-way analysis of variance (ANOVA). Tukey post-tests were used to investigate significant differential expression of transcripts throughout the investigated stages [24]. In all cases, the differences were considered significant when p b0.05.…”