The impact of microRNA-122 and its target gene Sestrin-2 on the protective effect of ghrelin in angiotensin II-induced cardiomyocyte apoptosis

Abstract

Ghrelin with n-octanoylated serine 3 residue is a peptide hormone with well-known cardioprotective properties.MicroRNA-122 is associated with the pathogenesis of many cardiovascular diseases, including apoptosis and was found highly increased in our previous rat model of post-myocardial infarction heart failure. In this study, we aimed to identify the target gene of microRNA-122 and to evaluate their impacts on the protective effect of acylated ghrelin in angiotensin II-induced apoptosis. The results showed that microRNA-122 was upregulated in the angiotensin II administration group accompanied by increased cell apoptosis, which were both reversed by ghrelin. Furthermore, microRNA-122 mimics upregulated numerous pro-apoptotic genes and increased apoptosis. The luciferase activity assay revealed Sestrin-2 as a direct target of microRNA-122.The expression of Sestrin-2 was downregulated by angiotensin II and upregulated by co-treatment with ghrelin. Inhibition of microRNA-122 and overexpression of Sestrin-2 alleviated apoptosis which was further reduced upon administered of ghrelin. Together, these results indicated that Sestrin-2 expression is inhibited by microRNA-122 and that this inhibition is involved in the protective effect of ghrelin and angiotensin II-induced apoptosis. We also found that microRNA-122 influenced several apoptosis pathways including the caspase cascade reaction and death receptor-mediated pathways. Collectively, our data reveal that microRNA-122 and its target gene Sestrin-2, under the regulation of angiotensin II and ghrelin, are important players in cardiomyocyte apoptosis. We therefore believe that microRNA-122 and Sestrin-2 can be developed as potential therapeutic targets against apoptosis in cardiovascular diseases.

Sestrin2 Signaling Pathway Regulates Podocyte Biology and Protects against Diabetic Nephropathy

“…Noncoding RNAs exert transcriptional and translational modifications and modulate signaling pathways in diabetic nephropathy [153]. It has been observed that several noncoding RNAs regulate Sestrin2 expression [154,155]. For instance, microRNA-122 delivery or inhibition of miR-148b-3p and miR-199a-5p increased Sestrin2 expression in animal studies and cell culture in previous studies [154,155].…”

Sestrin2 in cancer: a foe or a friend?

“…Recently, it was shown that non-coding RNAs are heavily involved in different stages of gene expression in cancer cells and interact with oncogenes, tumor-suppressor genes, and oncogenic signaling pathways [ 56 , 142 ]. New techniques such as non-coding RNAs delivery and vector systems can contribute to regulating the gene expression of Sestrin2 in cancer [ 118 , 143 ]. These methods of treatment as well as direct targeting of Sestrin2 can be used in future clinical trials.…”

Renal tissue toxicity and miRNA 21, miRNA122, and miRNA221 tissue level alterations in rats administered 4-Nitroquinoline

“…Table 1 indicates the single-stranded primers used for the synthesis of the cDNAs corresponding to the particular miRNA, namely miRNA-21, miRNA-122, miRNA-221, and U6 which was used as a housekeeping gene. (13) miR-122 GTCGTATCCAGTGCAGGGTCCGAGGTGCACTGGATACG ACCAAACAC RT (Wang et al, 2018) (14) miR-221 GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCAC TGGATACGACGAAACCC RT (Gong and Gong, 2018) (15) U6 CGCTTCACGAATTTGCGTGTCAT RT (Wang et al, 2018) (14) Complementary DNA was synthesized by utilizing total RNA as a template and the use of ProtoScript® First Strand cDNA Synthesis Kit according to the instructions of the manufacturing company. The following program was applied for the generation of cDNAs (Table 2).…”

“…Four primes' sets (Forward and reverse) were used for the amplification of the cDNA of interest (Table 3). (13) miR-122 F 3´ TGCGGTTGGAGTGTGACAATGG 5´ R 3´CAGTGCAGGGTCCGAGGT 5´ (Wang et al, 2018) (14) miR-221 F 3´ GGAGCTACATTGTCTGCTGG 5´ R 3´ CAGTGCGTGTCGTGGAGT 5´ (Gong and Gong, 2018) (15) U6 F 3´ CTCGCTTCGGCAGCACA 5´ R 3´AACGCTTCACGAATTTGCGT 5´ (Wang et al, 2018) (14) The reaction components with their relevant volumes are demonstrated in Table 4. The qRT-PCR reaction conditions were programmed as shown in Table 5.…”