The Expression of Porcine Prdx6 Gene Is Up-Regulated by C/EBPβ and CREB

Abstract

Peroxiredoxin6 (Prdx6) is one of the peroxiredoxin (Prdxs) family members that play an important role in maintaining cell homeostasis. Our previous studies demonstrated that Prdx6 was significantly associated with pig meat quality, especially meat tenderness. However, the transcriptional regulation of porcine Prdx6 remains unclear. In this study, we determined the transcription start site (TSS) of porcine Prdx6 gene by 5′ rapid-amplification of cDNA ends (5′ RACE). Several regulatory elements including CCAAT/enhancer-binding proteinβ (C/EBPβ), Myogenic Differentiation (MyoD), cAMP response element binding protein (CREB), stimulating protein1 (Sp1) and heat shock factor (HSF) binding sites were found by computational analyses together with luciferase reporter system. Overexpression and RNA interference experiments showed that C/EBPβ or CREB could up-regulate the expression of porcine Prdx6 gene at both mRNA and protein level. Electrophoretic mobility shift assays (EMSA) and chromatin immunoprecipitation assays (ChIP) confirmed that C/EBPβ and CREB could interact with Prdx6 promoter. Immuoprecipitation results also showed that C/EBPβ could interact with Prdx6 in vivo. Taken together, our findings identified C/EBPβ and CREB as the important regulators of porcine Prdx6 gene expression, and offered clues for further investigation of Prdx6 gene function.

Isolation and characterisation of peroxiredoxin 6 promoter from sheep (Ovis aries)

“…2. However, we did not find the classic TATA-box in 5′ flanking region of OaPrdx6 gene, and this result was consistent with the previous report (14). There were two core promoters (CP) predicted and named as CP1: 1839 CTGGAAGCCCTATTTATTCCGCCCCCAGCAC CTACACCGCCAGAACCAGC 1889 and CP2: 1706 CGC CCGGGTCGCCGCCGCTGCCAGACGCCAGACGC GGCCCCGCCCACCCT 1756 shown in Fig.…”

Peroxiredoxin 6 in the repair of peroxidized cell membranes and cell signaling

“…The effects of KGF and dexamethasone on Prdx6 protein expression are synergistic, consistent with their regulatory effect via separate but interactive elements in the Prdx6 DNA promoter [106]. Prdx6 expression also is regulated by the transcription factors CCAAT/enhancer protein β (C/EBPβ) and cAMP response element binding protein (CREB) [107]. …”

The role of peroxiredoxins in cancer

“…PRDX6 has a widespread distribution in all organs, and essentially in all cell types ( 130 ). Its expression is regulated by the mainly redox-active regulators, such as Nrf2, Nrf3 ( 132 , 133 ), NF-κB ( 134 ), Sp1 ( 135 ), c-Jun, c-Myc ( 130 ) and HSF1 ( 136 ), which are able to interact with the ARE and the putative GRE localized in the PRDX6 gene promoter region. PRDX6 has been reported to be implicated in the development and progression of several human diseases, such as Alzheimer's disease ( 137 ), Parkinson's dementia ( 138 ), diabetes ( 139 ), cataractogenesis ( 140 ) and cancer.…”