The equine herpesvirus-1 (EHV-1) IR3 transcript downregulates expression of the IE gene and the absence of IR3 gene expression alters EHV-1 biological properties and virulence

Abstract

The IR3 transcript of equine herpesvirus-1 (EHV-1) harbors 117 nts antisense to the immediate-early (IE) mRNA, suggesting it plays a regulatory role. Here, we show that the IR3 transcript downregulates IE gene expression and that the absence of IR3 expression altered EHV-1 biological properties and virulence in mice. Reporter assays revealed that the IR3/IE overlapping sequences [IR3(+226/+342)] and an additional IR3(+343/+433) region are necessary for the IR3 RNA to downregulate IE expression. Experiments with the ΔIR3 EHV-1 showed that the IR3 gene is dispensable for EHV-1 replication. Protein expression of the IE and representative EHV-1 genes was increased in cells infected with ΔIR3 EHV-1 as compared to that of cells infected with wt EHV-1. The ΔIR3 EHV-1 exhibited increased virulence in mice as compared to the parent virus. The finding that the IR3 transcript affects IE gene expression extends the role of RNA as a regulatory molecule in alphaherpesvirus infection.

The UL4 protein of equine herpesvirus 1 is not essential for replication or pathogenesis and inhibits gene expression controlled by viral and heterologous promoters

“…A RacL11 BAC deleted for the UL4 gene was generated through galK BAC recombineering (Ahn et al, 2010; Warming et al, 2005). To replace the UL4 gene, PCR amplification (forward primer: 5’-TTATCGTTTATTTTCTCGCTGGCGCTCTTTGGCCGAGGTTATTCCCCTAGCCTGTTGACAATT AATCATCGGCA-3’ and reverse primer: 5’-ATGCTGCCGGCAAACCGCGCAGAACACTCATCTGATGCAGAGCCGCGGGATCAGCACTGTC CTGCTCCTT-3’) was used to append UL4 flanking sequences to the ends of the galK selection gene, and the subsequent PCR product was transformed into SW106 E. coli harboring the RacL11 BAC.…”

“…The early IR2 protein is a truncated form of the IE protein (Harty and O’Callaghan, 1991) and serves to down-regulate the expression from all classes of viral promoters (Kim et al, 2006). Lastly, the EHV-1 unique IR3 gene encodes a transcript that is antisense to the IE mRNA (Holden et al, 1992), is not translated to a detectable protein product (Ahn et al, 2007), and functions to down-regulate expression of the IE gene (Ahn et al, 2010). …”

The early UL3 gene of equine herpesvirus-1 encodes a tegument protein not essential for replication or virulence in the mouse

“…To construct a vL11ΔUL3 lacking the UL3 gene, GalK BAC technology was used as previously described (Ahn et al, 2010; Warming et al, 2005). The plasmid pRacL11 EHV-1 BAC (named pRacL11) (Rudolph et al, 2002) was transformed into SW106 E. coli .…”

“…Early regulatory gene products include the EICP0 protein (IECP0P), IR4 protein (IR4P) and UL5 protein (UL5P) that independently or synergistically with the IEP trans -activate early and late genes (Bowles et al, 2000; Holden et al, 1995; Smith et al, 1992). In addition, three early EHV-1 gene products, the IR2 protein (IR2P) (Harty and O’Callaghan, 1991; Kim et al, 2006), UL4 protein (UL4P) (Charvat et al, 2011), and IR3 RNA (Ahn et al, 2007, 2010), play a role in regulating viral gene expression as negative regulatory molecules.…”

Properties of an equine herpesvirus 1 mutant devoid of the internal inverted repeat sequence of the genomic short region

“…The early IR2 gene is located within the IE ( IR1 ) ORF and generates the IR2 protein (IR2P) that strongly downregulates expression of all genes as a potent negative regulator (Kim et al, 2006). The IR3 gene, unique to EHV-1, is trans -activated by the IE protein (IEP), EICP0 protein (EICP0P) and IR4 protein (IR4P) and produces a non-coding 1kb late transcript (Ahn et al, 2007; Holden et al, 1992a) that downregulates expression of the IE gene in a luciferase reporter system (Ahn et al, 2010). The early regulatory IR4P cooperates with the IEP to enhance expression of early and late viral genes (Holden et al, 1995) and comprises the major portion of the IR4/UL5 hybrid protein encoded by defective interfering particles (DIP) that can cause persistent EHV-1 infection (Chen et al, 1996, 1999; Ebner et al, 2008; Ebner and O'Callaghan, 2006).…”