The Egr-1 transcription factor directly activates PTEN during irradiation-induced signalling

Virolle, Thierry; Ed, Adamson; Bar-On, Tamir; Birle, Diana C.; Mercola, Dan; Mustelin, Tomas; Belle, de

doi:10.1038/ncb1201-1124

Cited by 373 publications

(386 citation statements)

References 23 publications

Supporting

Mentioning

369

Contrasting

Unclassified

Order By: Relevance

“…In contrast, p53 activates PTEN transcription by directly binding to a p53-binding element in the PTEN promoter (Stambolic et al, 2001). Egr1 has been reported to be a crucial PTEN transactivator by directly binding to the PTEN 5 0 -untranslated region (Virolle et al, 2001). In this study, we show that Egr1 provides a critical link between b-catenin/TCF signaling, induced by the loss of E-cadherin, and PTEN transcription.…”

Section: Regulation Of Pten Levels By Cell Density and E-cadherin-cadmentioning

confidence: 47%

“…Similarly, PTEN promoter activities were repressed by E-cadherin loss and could be restored by mouse E-cadherin overexpression in OVCAR-3 and SKOV-3 cells ( Figure 4D), suggesting that E-cadherin can regulate PTEN at the transcriptional level. As transcription of PTEN can be transactivated by Egr1, by binding to an Egr1-binding site in the PTEN promoter (Virolle et al, 2001), we examined the protein levels of Egr1 in transfected SKOV-3 and OVCAR-3 cells. Egr1 protein levels were reduced in E-cadherin-depleted cells, and could be restored by the overexpression of mouse E-cadherin (Figures 4B and C), suggesting that Egr1 may mediate the effects of E-cadherin on PTEN transcription.…”

Section: Loss Of E-cadherin Inhibits Pten Transcription Via Egr1 Downmentioning

confidence: 99%

“…To create the mutEgr1 construct, the PTEN2526/427-luc Egr1 site was changed to an EcoR1 restriction site using the following oligonucleotide 5 0 -AGGC GCCCGGGCTCCCGGCGAATTCGCGGAGGGGGCGGG CAGGCCGGCGGGCGGTGATGT-3 0 , and its reverse complement (Virolle et al, 2001).…”

Section: Cell Culture and Transfectionsmentioning

confidence: 99%

“…PTEN also modulates migration and proliferation by interaction with cell adhesion molecules such as E-cadherin and b-catenin (Subauste et al, 2005;Hu et al, 2007). It has been shown that PTEN transcription can be transactivated by early growth response gene 1 (Egr1), which binds directly to a consensus Egr1-binding motif in the PTEN promoter (Virolle et al, 2001). Recent studies suggest that E-cadherin modulates PTEN levels in breast cancer cells Fournier et al, 2009); however, the exact mechanism by which E-cadherin regulates PTEN levels is unclear.…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

E-cadherin inhibits tumor cell growth by suppressing PI3K/Akt signaling via β-catenin-Egr1-mediated PTEN expression

2011

View full text Add to dashboard Cite

E-cadherin is a cell-cell adhesion protein and tumor suppressor that is silenced in many malignancies. E-cadherin is thought to suppress tumor cell growth by antagonizing b-catenin signaling. However, the role of E-cadherin in ovarian cancer progression is still controversial. In this study, we showed that loss of E-cadherin induced ovarian cancer cell growth and constitutive activation of phosphoinositide 3-kinase (PI3K)/Akt signaling by the inhibition of phosphatase and tensin homolog (PTEN) transcription through the downregulation of early growth response gene 1 (Egr1). In addition, immunofluorescence microscopy and T-cell factor promoter/luciferase reporter assays showed that E-cadherin loss was associated with enhanced nuclear b-catenin signaling. Constitutive activation of PI3K/Akt signaling reinforced nuclear b-catenin signaling by inactivating glycogen synthase kinase-3b indicating cross-talk between the PI3K/Akt and b-catenin signaling pathways. Finally, we found that E-cadherin negatively regulates tumor cell growth, in part, by positively regulating PTEN expression via b-catenin-mediated Egr1 regulation, thus influencing PI3K/Akt signaling. In summary, endogenous E-cadherin inhibits PI3K/Akt signaling by antagonizing b-catenin-Egr1-mediated repression of PTEN expression. Thus, the loss of E-cadherin itself may contribute to dysregulated PI3K/Akt signaling through its effects on PTEN, or it may exacerbate the frequent activation of PI3K/Akt signaling that occurs as a result of overexpression, mutation and/or amplification.

show abstract

Section: Regulation Of Pten Levels By Cell Density and E-cadherin-cadmentioning

confidence: 47%

Section: Loss Of E-cadherin Inhibits Pten Transcription Via Egr1 Downmentioning

confidence: 99%

Section: Cell Culture and Transfectionsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

E-cadherin inhibits tumor cell growth by suppressing PI3K/Akt signaling via β-catenin-Egr1-mediated PTEN expression

2011

View full text Add to dashboard Cite

show abstract

“…The PTEN gene transcription is regulated by diverse transcriptional factors. C-Jun binds to the AP-1 site of the PTEN promoter and can suppress its transcription, whereas Egr-1 activates PTEN transcription by direct binding to the PTEN 5 0 untranslated region (Virolle et al, 2001). In addition, p53 has been reported as a crucial PTEN transactivator (Stambolic et al, 2001).…”

Section: Discussionmentioning

confidence: 99%

Id-1 activates Akt-mediated Wnt signaling and p27Kip1 phosphorylation through PTEN inhibition

et al. 2008

Oncogene

View full text Add to dashboard Cite

Inhibitor of differentiation-1 (Id-1) has been accepted as a putative oncogene to promote oncogenic processes through inactivation of tumor suppressors and activation of growth promoting pathways. Here, we show that Id-1 activates the Akt pathway by inhibition of phosphatase and tensin homologue deleted on chromosome 10 (PTEN) transcription through downregulation of p53. Id-1 negatively regulated both p53 and PTEN at the transcriptional level. In promoter assay with serial deletion and chromatin immunoprecipitation assay, the binding of p53 to the PTEN promoter was reduced by Id-1, suggesting that Id-1 regulates PTEN transcription through its p53 modulation. This led to Akt phosphorylation at Ser473 and the activation of the Akt-mediated canonical Wnt signaling pathway. The glycogen synthase kinase-3b phosphorylation at Ser9, stabilization and nuclear localization of b-catenin, T-cell factor (TCF)/lymphoid enhancer factor transactivation activity and cyclin D1 expression were enhanced by Id-1. On the other hand, Akt-mediated p27 Kip1 phosphorylation at Thr157 and its cytosolic localization were also increased in Id-1 overexpressing MCF7 cells. In conclusion, our results disclose Id-1 as a novel PTEN inhibitor that could activate the Akt pathway and its downstream effectors, the Wnt/TCF pathway and p27 Kip1 phosphorylation and suggest that the oncogenic function of Id-1 may be partly attributed to its PTEN inhibition in human breast carcinogenesis.

show abstract

High glucose increases miR‐214 to power a feedback loop involving PTEN and the Akt/mTORC1 signaling axis

et al. 2019

View full text Add to dashboard Cite

The mechanism of PTEN repression by high glucose in diabetic nephropathy is not known. Using proximal tubular cells, we show that inhibition of PI3 kinase/Akt and their inactive enzymes prevents high glucose‐induced PTEN downregulation. Similarly, rapamycin (Rapa) and shRaptor block suppression of PTEN by high glucose. In contrast, the constitutive activation of Akt and mechanistic target of rapamycin (mTOR)C1 decrease the expression of PTEN, similarly to high glucose. Remarkably, PI3 kinase/Akt/mTORC1 inhibition significantly attenuates high glucose‐stimulated increase in miR‐214, which targets PTEN, while constitutively active Akt/mTORC1 increases miR‐214. Furthermore, anti‐miR‐214 and mTORC1 inhibition block high glucose‐induced hypertrophy and fibronectin expression. These results reveal the first evidence for the presence of a high glucose‐forced positive feedback conduit between the three‐layered kinase cascade and miR‐214/ PTEN in tubular cell injury.

show abstract

The Egr-1 transcription factor directly activates PTEN during irradiation-induced signalling

Cited by 373 publications

References 23 publications

E-cadherin inhibits tumor cell growth by suppressing PI3K/Akt signaling via β-catenin-Egr1-mediated PTEN expression

E-cadherin inhibits tumor cell growth by suppressing PI3K/Akt signaling via β-catenin-Egr1-mediated PTEN expression

Id-1 activates Akt-mediated Wnt signaling and p27Kip1 phosphorylation through PTEN inhibition

High glucose increases miR‐214 to power a feedback loop involving PTEN and the Akt/mTORC1 signaling axis

Contact Info

Product

Resources

About