The effects of threshing and redrying on bacterial communities that inhabit the surface of tobacco leaves

Abstract

Before being subjected to the aging process, raw tobacco leaves (TLs) must be threshed and redried. We propose that threshing and redrying affect the bacterial communities that inhabit the TL surface, thereby influencing the aging process. However, these effects remain unclear. In this study, Illumina sequencing was applied to analyze the bacterial communities on both raw and redried TLs. Shannon's diversity value decreased from 3.38 to 2.52 after the threshing and redrying processes, indicating a large reduction in TL bacterial diversity. The bacterial communities also largely differed between raw TLs and redried TLs. On unaged raw TLs, Proteobacteria was the most dominant phylum (56.15%), followed by Firmicutes (38.99%). In contrast, on unaged redried TLs, Firmicutes (76.49%) was the most dominant phylum, followed by Proteobacteria (21.30%). Thus, the dominant genus Proteobacteria, which includes Sphingomonas, Stenotrophomonas, and Pantoea, decreased after the threshing and redrying processes, while the dominant genus Firmicutes, which includes Bacillus and Lactococcus, increased. Changes in the bacterial communities between raw and redried TLs were also noted after 1 year of aging. The relative abundance of dominant Proteobacteria taxa on raw TLs decreased from 56.15 to 16.92%, while the relative abundance of Firmicutes taxa increased from 38.99 to 79.10%. However, small changes were observed on redried TLs after 1 year of aging, with a slight decrease in Proteobacteria (21.30 to 17.64%) and a small increase in Firmicutes (76.49 to 79.10%). Based on these results, Firmicutes taxa may have a higher tolerance for extreme environments (such as high temperature or low moisture) than Proteobacteria bacteria. This study is the first report to examine the effects of threshing and redrying on bacterial communities that inhabit TLs.

Microbial community and metabolic function analysis of cigar tobacco leaves during fermentation

“…Genomic DNA was extracted based on previous studies (Su et al, 2011 ; Ye et al, 2017 ; Zhang, Acuña, et al, 2019 ). For each biological replicate, 60 g of CTLs was ground with liquid nitrogen and then divided into three equal parts, namely the technical replicates; then, the DNA extracted from the three technical replicates of each sample was pooled into one DNA sample to minimize any potential DNA extraction bias.…”

“…The fungal internal transcribed spacer gene was amplified using the universal primers ITS1F (5ʹ‐CTTGGTCATTTAGAGGAAGTAA‐3ʹ) and ITS2R (5ʹ‐GCTGCGTTCTTCATCGATGC‐3ʹ). The PCR system and program were chosen based on a previous study (Ye et al, 2017 ). The PCR products were extracted and purified using an AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA) following the manufacturer's instructions.…”

“…The fungal internal transcribed spacer gene was amplified using the universal primers ITS1F (5ʹ-CTTGGTCATTTAGAGGAAGTAA-3ʹ) and ITS2R (5ʹ-GCTGCGTTCTTCATCGATGC-3ʹ). The PCR system and program were chosen based on a previous study (Ye et al, 2017).…”

Bioaugmentation of Bacillus amyloliquefaciens-Bacillus kochii co-cultivation to improve sensory qualities of flue-cured tobacco

“…Tobacco (Nicotiana tabacum L.) is a special industrial crop planted in over 120 countries and regions (Ye et al, 2017). Most of fresh tobacco is made into ue-cured tobacco (FCT).…”

“…The aging process usually takes 1 to 2 years, which is long along with low e ciency. It is necessary to seek approaches to enhance sensory the aging e ciency (Ye et al 2017;. Previous studies has reported that some speci c functional microorganisms were high effective in improving the quality (Chortyk O. T. et al 1973;He 2013;Li et al 2019) or degrading nicotine of FCT (He et al 2019) in aging process.…”