The effect of dietary total antioxidant capacity (DTAC) and Caveolin-1 gene variant interaction on cardiovascular risk factors among overweight and obese women: A cross-sectional investigation

Mirzababaei, Atieh; Shiraseb, Farideh; Abaj, Faezeh; Khosroshahi, Reza Amiri; Tavakoli, Atefeh; Koohdani, Fariba; Clark, Cain C. T.

doi:10.1016/j.clnu.2021.07.013

Cited by 11 publications

(12 citation statements)

References 62 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…No significant interactions were observed between CAV-1 rs3807992 variants and uPDI for other metabolic-related traits. A cross-sectional study in 2021 revealed that, among people following antioxidant-rich diets, ‘A’ allele carriers might be more vulnerable to cardiovascular disorders; the authors also reported no significant relationship between higher adherence to dietary total antioxidant capacity (DTAC) and changes in lipid profile, HOMA-IR, and body composition components 27 .…”

Section: Discussionmentioning

confidence: 99%

“…Based on a previous study 27 , the Mini Columns kit (Type G; Genall; Exgene) was used for DNA extraction. The CAV-1 SNP (rs3807992) was genotyped by PCR–RFLP method, using primers, Forward: 3′AGTATTGACCTGATTTGCCATG5′ Reverse: 5′GTCTTCTGGAAAAAGCACATGA-3′.…”

Section: Methodsmentioning

confidence: 99%

“…The CAV-1 SNP (rs3807992) was genotyped by PCR–RFLP method, using primers, Forward: 3′AGTATTGACCTGATTTGCCATG5′ Reverse: 5′GTCTTCTGGAAAAAGCACATGA-3′. The sequencing process was performed using the ABI PRISM 3730 automated sequencer (Applied Biosystems, Foster City, Calif, USA) 27 .…”

Section: Methodsmentioning

confidence: 99%

“…Therefore, PBD may be associated with an improvement in obesity-related inflammatory profiles and inhibition of chronic diseases risks. Indeed, recent studies have revealed that there might be an interaction between specific genes such as Caveolin-1 and particular dietary patterns 26 , 27 .…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Interactions between Caveolin-1 polymorphism and Plant-based dietary index on metabolic and inflammatory markers among women with obesity

Abaj

Mirzababaei

Hosseininasab

et al. 2022

Sci Rep

Self Cite

View full text Add to dashboard Cite

A series of recent studies have indicated that the Caveolin-1 (CAV-1) gene variant may be associated with metabolic and inflammatory markers and anthropometric measures. Furthermore, it has been shown that a plant-based dietary index (PDI) can elicit a positive impact on these metabolic markers. Therefore, we sought to examine whether PDI intakes may affect the relationship between CAV-1 (rs3807992) and metabolic factors, as well as serum inflammatory markers and anthropometric measures, in women with obesity. This current study consisted of 400 women with overweight and obesity, with a mean (SD) age of 36.67 ± 9.10 years. PDI was calculated by a food frequency questionnaire (FFQ). The anthropometric measurements and serum profiles were measured by standard protocols. Genotyping of the CAV-1(rs3807992) was conducted by the PCR–RFLP method. The following genotypic frequencies were found among the participants: GG (47.8%), AG (22.3%), and AA (2.3%). In comparison to GG homozygotes, risk-allele carriers (AA + AG) with higher PDI intake had lower ALT (P: 0.03), hs-CRP (P: 0.008), insulin (P: 0.01) and MCP-1 (P: 0.04). Furthermore, A-allele carriers were characterized by lower serum ALT (P: 0.04), AST (P: 0.02), insulin (P: 0.03), and TGF-β (P: 0.001) when had the higher following a healthful PDI compared to GG homozygote. Besides, risk-allele carriers who consumed higher unhealthful PDI had higher WC (P: 0.04), TC/HDL (P: 0.04), MCP-1 (P: 0.03), and galactin-3 (P: 0.04). Our study revealed that A-allele carriers might be more sensitive to PDI composition compared to GG homozygotes. Following a healthful PDI in A-allele carriers may be associated with improvements in metabolic and inflammatory markers and anthropometric measures.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Interactions between Caveolin-1 polymorphism and Plant-based dietary index on metabolic and inflammatory markers among women with obesity

Abaj

Mirzababaei

Hosseininasab

et al. 2022

Sci Rep

Self Cite

View full text Add to dashboard Cite

show abstract

“…Body composition, including weight, fat, and lean mass, and waist-to-hip ratio was assessed using a bioelectric impedance analyzer (In Body 770 scanner, Korea) [ 32 ]. Also, height was measured to the nearest 0.5 cm by nonelastic tape, while BMI was calculated as weight (kg) divided by height (m 2 ).…”

Section: Methodsmentioning

confidence: 99%

Circulating Inflammatory Markers May Mediate the Relationship between Healthy Plant-Based Diet and Metabolic Phenotype Obesity in Women: A Cross-Sectional Study

Mohamadi

Shiraseb

Mirzababaei

et al. 2022

International Journal of Clinical Practice

Self Cite

View full text Add to dashboard Cite

Background. It has been posited that both metabolically healthy obesity (MHO) and metabolically unhealthy obesity (MUHO) could be emergent from diet and inflammatory markers. Thus, we sought to investigate the influence of plant-based diet on MHO and MUHO phenotypes mediated by inflammatory markers in overweight and obese women. Methods. This cross-sectional study was conducted on 289 women aged ≥18 years, with a body mass index (BMI) ≥25 kg/m2. Dietary intake was measured using 147 item food frequency questionnaire, as well as anthropometrics and biochemistry panel, in all participants. Metabolic health phenotypes were considered using Karelis score, while plant-based diet indices (PDI) were evaluated based on 18 food groups, where healthy and unhealthy PDI were identified. Results. Accordingly, 26.9% of women had MHO and 73.1% had MUHO phenotypes. After adjusting for potential confounders, TGF-β1 had a significant inverse association with hPDI (β: −0.28; 95% CI: 452.99, −85.25; P : 0.004). Moreover, we found that women with higher hPDI had lower odds of MUHO (OR: 0.95; 95% CI: 0.39, 2.30; P : 0.03). Regarding the mediatory effect of the inflammatory markers, TGF-β1 ( P : 0.73), IL-β1 ( P : 0.14), and MCP1 ( P : 0.51) played a role in decreasing the odds of MUHO among hPDI tertiles. Conclusion. There was a significant inverse relationship between adherence to hPDI and MUHO phenotype in overweight and obese Iranian women. This association appeared to be mediated by TGF-β1, IL-β1, and MCP1.

show abstract

Association between DASH and novel atherogenic risk factors, anthropometric indices and foot ulcer indicators in type 2 diabetic patients with foot ulcer: a cross-sectional study

Jalalzadeh,

Nasli-Esfahani,

Montazer

et al. 2024

J Diabetes Metab Disord

View full text Add to dashboard Cite

The effect of dietary total antioxidant capacity (DTAC) and Caveolin-1 gene variant interaction on cardiovascular risk factors among overweight and obese women: A cross-sectional investigation

Cited by 11 publications

References 62 publications

Interactions between Caveolin-1 polymorphism and Plant-based dietary index on metabolic and inflammatory markers among women with obesity

Interactions between Caveolin-1 polymorphism and Plant-based dietary index on metabolic and inflammatory markers among women with obesity

Circulating Inflammatory Markers May Mediate the Relationship between Healthy Plant-Based Diet and Metabolic Phenotype Obesity in Women: A Cross-Sectional Study

Association between DASH and novel atherogenic risk factors, anthropometric indices and foot ulcer indicators in type 2 diabetic patients with foot ulcer: a cross-sectional study

Contact Info

Product

Resources

About