The dominant bacteria shifted from the order “Lactobacillales” to Bacillales and Actinomycetales during a start-up period of large-scale, completely-mixed composting reactor using plastic bottle flakes as bulking agent

Watanabe, Keiko; Nagao, Norio; Toda, Tatsuki; Kurosawa, Norio

doi:10.1007/s11274-008-9952-7

Cited by 27 publications

(16 citation statements)

References 27 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Genomic DNA was isolated from at least 1 g of three replicate mixed soils using the PowerSoil DNA Isolation Kit (MoBio) according to the manufacturer's instructions. Extracted DNA was stored at −20 • C. To amplify a 16S rRNA gene fragment of the appropriate size and sequence variability for 454 pyrosequencing, primers 27F (5 -AGAGTTTGATCCTGGCTCAG-3 , Escherichia coli position 9-27) and 515R (5 -TTACCGCGGCTGCTGGCAC-3 , E. coli position 533-515) were chosen (Watanabe et al 2009), and the primers 27F and B515R contained the 454 Life Sciences(R) adaptors B and A respectively. Based on these, the V1-V3 region of bacterial 16S rRNA genes was amplified.…”

Section: Dna Extraction Pcr and 454 Pyrosequencingmentioning

confidence: 99%

Bacterial diversity in the foreland of the Tianshan No. 1 glacier, China

Wu¹,

Zhang²,

et al. 2012

Environ. Res. Lett.

View full text Add to dashboard Cite

There is compelling evidence that glaciers are retreating in many mountainous areas of the world due to global warming. With this glacier retreat, new habitats are being exposed that are colonized by microorganisms whose diversity and function are less well studied. Here, we characterized bacterial diversity along the chronosequences of the glacier No. 1 foreland that follows glacier retreat. An average of 10 000 sequences was obtained from each sample by 454 pyrosequencing. Using non-parametric and rarefaction estimated analysis, we found bacterial phylotype richness was high. The bacterial species turnover rate was especially high between sites exposed for 6 and 10 yr. Pyrosequencing showed tremendous bacterial diversity, among which the Acidobacteria, Actinobacteria, Bacteroidetes and Proteobacteria were found to be present at larger numbers at the study area. Meanwhile, the proportion of Bacteroidetes and Proteobacteria decreased and the proportion of Acidobacteria increased along the chronosequences. Some known functional bacterial genera were also detected and the sulfur-and sulfate-reducing bacteria were present in a lower proportion of sequences. These findings suggest that high-throughput pyrosequencing can comprehensively detect bacteria in the foreland, including rare groups, and give a deeper understanding of the bacterial community structure and variation along the chronosequences.

show abstract

Section: Dna Extraction Pcr and 454 Pyrosequencingmentioning

confidence: 99%

Bacterial diversity in the foreland of the Tianshan No. 1 glacier, China

Wu¹,

Zhang²,

et al. 2012

Environ. Res. Lett.

View full text Add to dashboard Cite

show abstract

“…The bar-coded primers 27F and 533R containing A and B sequencing adaptors (454 Life Sciences) were used. The forward primer (B-27F) was 5′- CCTATCCCCTGTGTGCCTTGGCAGTCGACT AG AGTTTGATCCTGGCTCAG-3′, where the sequence of the B adaptor is shown in italics and underline, the reverse primer (A-533R) was 5′- CCATCTCATCCCTGCGTGTCTCCGACGACT NNNNNNNNNNTTACCGCGGCTGCTGGCAC-3′, where the sequence of the A adaptor is shown in italics and underlined and the Ns represent a ten-base sample specific barcode sequence [26] .…”

Section: Methodsmentioning

confidence: 99%

Influence of Trace Elements Mixture on Bacterial Diversity and Fermentation Characteristics of Liquid Diet Fermented with Probiotics under Air-Tight Condition

et al. 2014

View full text Add to dashboard Cite

Cu2+, Zn2+, Fe2+ and I− are often supplemented to the diet of suckling and early weaning piglets, but little information is available regarding the effects of different Cu2+, Zn2+, Fe2+ and I− mixtures on bacteria growth, diversity and fermentation characteristics of fermented liquid diet for piglets. Pyrosequencing was performed to investigate the effect of Cu2+, Zn2+, Fe2+ and I− mixtures on the diversity, growth and fermentation characteristics of bacteria in the liquid diet fermented with Bacillus subtilis and Enterococcus faecalis under air-tight condition. Results showed that the mixtures of Cu2+, Zn2+, Fe2+ and I− at different concentrations promoted Bacillus growth, increased bacterial diversity and lactic acid production and lowered pH to about 5. The importance of Cu2+, Zn2+, Fe2+ and I− is different for Bacillus growth with the order Zn2+> Fe2+>Cu2+> I− in a 21-d fermentation and Cu2+>I−>Fe2+>Zn2+ in a 42-d fermentation. Cu2+, Zn2+, Fe2+ and I− is recommended at a level of 150, 60, 150 and 0.6 mg/kg respectively for the production of fermented liquid diet with Bacillus subtilis. The findings improve our understanding of the influence of trace elements on liquid diet fermentation with probiotics and support the proper use of trace elements in the production of fermented liquid diet for piglets.

show abstract

“…The proliferation of Actinobacteria during the late period may be related to the decomposition of cellulose [31,42,45]. The shift of bacteria community to Bacillales and Actinomycetales in the composting process was also proved by the molecular method of 16S rRNA DGGE analysis [44]. Component analysis of the quinone profile further indicated the change of microbial community structure and its variation with different raw materials (Fig.…”

Section: Change Of Microbial Properties During Composting Processmentioning

confidence: 96%

Effects of Raw Materials and Bulking Agents on the Thermophilic Composting Process

Tang

Zhou²,

Katayama³

2010

J. Microbiol. Biotechnol.

View full text Add to dashboard Cite

Three typical biological solid wastes, namely, animal manure, garbage, and sewage sludge, were compared with regard to the composting process and the changes in microbial community structure. The effects of different bulking agents such as rice straw, vermiculite, sawdust, and waste paper were compared in manure compost. The differences in the microbial community were characterized by the quinone profile method. The highest mass reduction was found in garbage composting (56.8%), compared with manure and sludge (25% and 20.2%, respectively). A quinone content of 305.2 µmol/kg was observed in the late stage of garbage composting, although the diversity index of the quinone profile was 9.7, lower than that in manure composting. The predominant quinone species was found to be MK-7, which corresponds to Gram-positive bacteria with a low G+C content, such as Bacillus. The predominance of MK-7 was especially found in the garbage and sludge composting process, and the increase in quinones with partially saturated long side-chains was shown in the late composting process of manure, which corresponded to the proliferation of Actinobacteria. The effects of different bulking agents on the composting process was much smaller than the effects of different raw materials. High organic matter content in the raw materials resulted in a higher microbial biomass and activity, which was connected to the high mass reduction rate.

show abstract

The dominant bacteria shifted from the order “Lactobacillales” to Bacillales and Actinomycetales during a start-up period of large-scale, completely-mixed composting reactor using plastic bottle flakes as bulking agent

Cited by 27 publications

References 27 publications

Bacterial diversity in the foreland of the Tianshan No. 1 glacier, China

Bacterial diversity in the foreland of the Tianshan No. 1 glacier, China

Influence of Trace Elements Mixture on Bacterial Diversity and Fermentation Characteristics of Liquid Diet Fermented with Probiotics under Air-Tight Condition

Effects of Raw Materials and Bulking Agents on the Thermophilic Composting Process

Contact Info

Product

Resources

About