The distribution of MNS hybrid glycophorins with Mur antigen expression in Chinese donors including identification of a novel GYP.Bun allele

Abstract

GP.Mur (Mi.III) is the main Mur-positive hybrid glycophorin in Guangzhou donors. The dosage effect of Mur antigen observed provides a basis for selecting the homozygous GP.Mur RBCs as the reagent cells to avoid neglecting weak antibodies. A separate GYP.Bun lineage found in the southern China provides evidence for further complexity in the MNS system.

Genotyping analysis of MNS blood group GP(B‐A‐B) hybrid glycophorins in the Chinese Southern Han population using a high‐resolution melting assay

“…HRM genotyping analysis for GP(B‐A‐B) hybrid glycophorins in the 3104 Chinese donors identified that GP.Mur was the most predominant hybrid glycophorin consistent with our previous study . The two GP.Bun samples identified in this study carry the same GYP*Bun (GenBank KR363627) allele we described recently, and the same allele was also reported in Taiwan and Shanghai previously. This indicates that this GYP*Bun allele, different from the reference GYP*Bun (M60710) allele, is the predominant GYP*Bun allele for Chinese individuals with a GP.Bun phenotype.…”

“…Two samples were genotyped as GYP*Bun/GYPB . The GYP*Bun sequence detected in these samples was identical to GYP*Bun (KR363627), but not to the reference GYP*Bun (M60710).…”

“…Pseudoexon 3 and adjacent introns of the GYPB gene were amplified and sequenced using the primers and protocols described before . TA cloning and subsequent sequencing of the hybrid region and sequencing for all exons of the GYPB gene were conducted for the novel heterozygous GYP(B‐A‐B) allele identified using the primers described previously . An additional GYPB ‐specific forward primer (5′‐CTGTAAACCTCTGCTGTACAA‐3′) targeting GYPB Exon 2 was used for subsequent nucleotide sequencing analysis .…”

“…A total of 106 selected samples (106/3104) genotyped by PCR HRM as with a heterozygous GYP*Mur/GYPB genotype (n = 50), a wild type GYPB/GYPB genotype (n = 50), a homozygous GYP*Mur / GYP*Mur genotype (n = 3), a heterozygous GYP*Bun/GYPB genotype (n = 2), and a heterozygous GYP*HF/GYPB genotype (n = 1) were selected for genotyping by the blood MLPA assay. The MLPA analysis was performed as described previously …”

The prevalence, immunogenicity, and evanescence of alloantibodies to MUT and Mur antigens of GP.Mur red blood cells in a Southeast Asian patient cohort

“…These variant GPs are generally considered as low frequency. However, prevalence of certain variant GPs, in particular GP.Mur (Mi.III) is relatively high among Asians, particularly those of Southeast and East Asian descent . GP.Mur frequency of 4% to 8% has been reported among populations in Thailand, Malaysia, and China .…”