The determination of the primary structure of the 16S ribosomal RNA of Escherichia coli(2) Nucleotide sequences of products from partial enzymatic hydrolysis

Ehresmann, Chantal; Stiegler, Patrick; Fellner, Peter; Ebel, Jean‐Pierre

doi:10.1016/s0300-9084(72)80007-5

Cited by 89 publications

(45 citation statements)

References 12 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This step served to dissociate the RNA fragments from the protein and from each other, and to fractionate them. The introduction of a gel layer lacking electrophoresis buffer caused a zonesharpening effect, described by Vigne and Jordan [ 15] and Ehresmann et al [ 14], which presumably contributed to the very good separation reproducibly obtained.…”

Section: 41mentioning

confidence: 91%

See 1 more Smart Citation

The identification of the RNA binding site for a 50 s ribosomal protein by a new technique

et al. 1973

View full text Add to dashboard Cite

Section: 41mentioning

confidence: 91%

“…These procedures have been largely previously described by Ehresmann et al [14], and are summarised here.…”

Section: Polyacrylamide Gel Electrophoresismentioning

confidence: 99%

The identification of the RNA binding site for a 50 s ribosomal protein by a new technique

et al. 1973

View full text Add to dashboard Cite

“…M13 mplO recombinant phages were grown in E. coli JMlOl(49) which was grown in YT broth (0.8% Bacto Tryptone, 0.5% yeast extract, 0.5% NaC1). The Thermus species were grown at temperatures appropriate for each isolate ( TTGTTGGAGAGTTTGATCCTG AAAGGAGGTGATCCAGCCGCACCTTC ACTCCTACGGGAGGCAGCAG QCCAGCAGCCGCGGTAATAC GGATTAGATACCC(G/T)(G/T)GTAGTCC GGGTTAAGTCCCGCAACGAG CTGCTGCCTCCCGTAGGAGT GTATTACCGCGGCTGCTGGC GCOACTAC(C/A)(C/A)GQGTATCTAATCC CTCGTTGCGGGACTTAACCC ' The positions of primers RNAl to RNA8 are the coordinates of the primers on the 16s rRNA sequence of E. cofi (10). The sequences of PCRl and PCR2…”

Section: Methodsmentioning

confidence: 99%

Phylogeny of Twenty Thermus Isolates Constructed from 16S rRNA Gene Sequence Data

Saul

Rodrigo

Reeves

et al. 1993

International Journal of Systematic Bacteriology

View full text Add to dashboard Cite

The sequences of the 16s rRNA genes of 20 lltermus isolates were determined to a high fidelity by using automated DNA sequencing and fluorescent-dye-labelled primers. The strains tested included members of the three validly named Thennus species and representatives of major taxonomic clusters defined previously for this genus. The parsimony method was used to reconstruct the phylogeny of the strains from the aligned sequences, and a bootstrap analysis revealed a number of well-supported clades. Our results are not consistent with groupings inferred from numerical taxonomy data but support the conjecture that the genus Thennus contains more species than the three currently recognized species.Since the original description of the genus Thermus by Brock and Freeze (4), the ubiquitous nature of members of this taxon has been demonstrated by the ready isolation of strains from neutral-pH thermal areas around the world (reviewed in reference 48). The genus Thermus represents a deep eubacterial branch (16) and contains three validly named species: Thermus aquaticus (4), Thermus ruber (26), and Thermus filiformis (20). Many other Thermus isolates have been described in some detail but have not yet been validly named; the taxonomy of the genus is still incomplete. While there is general agreement that T. ruber and T. aquaticus are taxonomically and phylogenetically distinct (17), it is still unclear whether the yellow-pigmented isolates that grow at 70°C constitute a single species or more than one species. In a numerical taxonomic study Hudson et al. (21) discerned eight species groups which were separated at a simple matching coefficient value of 65%, while Williams (47) suggested that there are at least four genospecies on the basis of DNA-DNA hybridization data and other properties. In both cases there were strong indications that strains isolated from the same thermal region shared common properties and grouped together. A comparison of results is difficult because different strains have been used in different studies.In this study the sequences of the 16s rRNA genes of 20 Thermus strains were determined by using a procedure developed specifically to provide high-fidelity data with an automated DNA sequencer, and the aligned sequences were subjected to phylogenetic analysis. The complete 16s rRNA gene sequence of "Thermus thermophilus" HB8 (29) and a partial sequence of T. aquaticus (45) were available from other sources, but the results described below were derived from our own sequence versions. The 20 strains included representatives of the major clusters defined in the study of Hudson et al. (21) and the three validly named species, as well as two "T. thermophilus" strains (HB8 and HB27) and '' Thermus flavus . "Phylogenetic systematics is a two-stage process. The first stage is the estimation of a phylogenetic tree, and for this we used aligned sequence data and reconstructed the phylogeny by using the criterion of maximum parsimony (44). The * Corresponding author. second stage is the translation of the phyl...

show abstract

“…In sequencing E. coli rRNA, Fellner and his associates have found certain rather long sequences (up to 17 residues) containing only G and A, except for one or two pyrimidine residues (Fellner et al, 1972a,b;Ehresmann et al, 1972). Furthermore, there are several homologous sequences rich in G and A residues.…”

Section: (C) Metastable Quanine -Gumande Structures May Underlie the Hymentioning

confidence: 99%

Metastable secondary structures in ribosomal RNA molecular hysteresis in the acid-base titration of Escherichia coli ribosomal RNA

Revzin

Neumann

Katchalsky

1973

Journal of Molecular Biology

View full text Add to dashboard Cite

The metastable conformational states which underlie the hysteresis displayed by Escherichia coli ribosomal RNA in its pH titration in the acid range have been analyzed in terms of acid-stable RNA secondary structures. Sedimentation measurements show that the phenomenon is ktramolecular, so that analysis of the hysteresis loops can, in principle, reveal details of molecular architecture. Hysteresis cycles obtained spectrophotometrically and potentiometrically were compared for RNA in solutions of different ionic strengths and ionic compositions. The effect is much smaller at lower ionic strength and disappears in the absence of magnesium ions. The curve followed upon addition of acid appears to reflect the equilibrium state of the system at each pH value. On the "base branch" of the loop, a slow absorbance change (complete in hours) was observed after the pH was raised by addition of a portion of base. This slow process is attributed to the annealing of "mismatched" multihelical regions of the ribosomal RNA. Certain regions, however, remain in metastable configurations for days and it is these long-lived non-equilibrium structures that underlie the hysteresis. Titration at 35°C gave hysteresis loops of the same size and shape as at 20°C ; indeed, we found that the metastabilities are not removed even at 80°C. Ultraviolet light absorbance difference spectra at 80°C between solutions at the same pH, but on different branches of the cycle, give insight into the nature of the metastable conformation(s).Our experimental observations lead us to propose that the hysteresis is due to the formation at acidic pH of double-helical structures involving protonated guanine and adenine base pairs. The G.G pairs seem especially important to account for the very high thermal stability, as well as for the fact that the structures formed at a given pH value as acid is added dissociate only at higher pH values when the solution is titrated with base. Titrations of transfer RNA, along with literature data on 16 S rRNA primary structure, imply that the metastable regions in rRNA may consist of perhaps 10 to 15 base pairs.

show abstract

The determination of the primary structure of the 16S ribosomal RNA of Escherichia coli(2) Nucleotide sequences of products from partial enzymatic hydrolysis

Cited by 89 publications

References 12 publications

The identification of the RNA binding site for a 50 s ribosomal protein by a new technique

The identification of the RNA binding site for a 50 s ribosomal protein by a new technique

Phylogeny of Twenty Thermus Isolates Constructed from 16S rRNA Gene Sequence Data

Metastable secondary structures in ribosomal RNA molecular hysteresis in the acid-base titration of Escherichia coli ribosomal RNA

Contact Info

Product

Resources

About