The B<sub>3</sub> phenotype in Chinese

Lin‐Chu, M.; Broadberry, Richard E.; Chiou, Peter Wen-Shyg

doi:10.1046/j.1537-2995.1986.26587020118.x

Cited by 14 publications

(16 citation statements)

References 4 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The B 3 transcript without exon 3 predicts a B glycosyltransferase that lacks 19 amino acids at the N-terminal segment. The frequency of B 3 among group AB Chinese persons are approximately 1 in 900 [16]. Although B 3 is the most common B subtype in the Chinese population, only two articles have been published to address the molecular and genetic basis of B 3 [15], [17].…”

Section: Introductionmentioning

confidence: 99%

Genetic and Mechanistic Evaluation for the Mixed-Field Agglutination in B3 Blood Type with IVS3+5G>A ABO Gene Mutation

et al. 2012

View full text Add to dashboard Cite

BackgroundThe ABO blood type B3 is the most common B subtype in the Chinese population with a frequency of 1/900. Although IVS3+5G>A (rs55852701) mutation of B gene has been shown to associate with the development of B3 blood type, genetic and mechanistic evaluation for the unique mixed-field agglutination phenotype has not yet been completely addressed.Methodology/Principal FindingsIn this study, we analyzed 16 cases of confirmed B3 individuals and found that IVS3+5G>A attributes to all cases of B3. RT-PCR analyses revealed the presence of at least 7 types of aberrant B3 splicing transcripts with most of the transcripts causing early termination and producing non-functional protein during translation. The splicing transcript without exon 3 that was predicted to generate functional B3 glycosyltransferase lacking 19 amino acids at the N-terminal segment constituted only 0.9% of the splicing transcripts. Expression of the B3 cDNA with exon 3 deletion in the K562 erythroleukemia cells revealed that the B3 glycosyltransferase had only 40% of B1 activity in converting H antigen to B antigen. Notably, the typical mixed-field agglutination of B3-RBCs can be mimicked by adding anti-B antibody to the K562-B3 cells.Conclusions/SignificanceThis study thereby demonstrates that both aberrant splicing of B transcripts and the reduced B3 glycosyltransferase activity contribute to weak B expression and the mixed-field agglutination of B3, adding to the complexity for the regulatory mechanisms of ABO gene expression.

show abstract

Section: Introductionmentioning

confidence: 99%

Genetic and Mechanistic Evaluation for the Mixed-Field Agglutination in B3 Blood Type with IVS3+5G>A ABO Gene Mutation

et al. 2012

View full text Add to dashboard Cite

show abstract

“…However, the molecular polymorphisms causing these subgroups have been found to vary across ethnic groups and/or with the variation in phenotype [3]. The A 2 subgroup is rare in Taiwan compared to Western countries; while in contrast, the B 3 phenotype (0.03%) is the most common ABO subgroup in Taiwan [12]. A variety of molecular changes in the A allele can cause the A 2 phenotype.…”

Section: Introductionmentioning

confidence: 99%

Molecular basis of the A2B in Taiwan

Chang

Lin²,

Chang

et al. 2008

Int J Hematol

View full text Add to dashboard Cite

Molecular genotyping of the ABO alleles has been widely used in ABO subgroups analysis and has been able to solve the rare ABO blood grouping discrepancies. The genotypes of sixty-one A2B phenotype donors recruited from the middle and south of Taiwan were analyzed by means of molecular methods. The A2B phenotype was initially identified by serological test. The polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was used to screen the ABO alleles at nucleotides (nt) 261 and 703 based on the nt differences found in the ABO alleles. The subgroups of the A2 allele were determined by the PCR-RFLP and direct sequencing methods. The discrepancies between the phenotype and genotype of the A2B were then studied by subcloning and nucleotide sequence analysis. Our results show that 55 of the 61 A2B donors (90%) are A205/B allele and two are A201/B allele. Four cases were heterozygotes of the cis-AB/O or B alleles. Two were cis-AB04/O allele, one was cis-AB01/O allele and the other was cis-AB02/B allele. In conclusion, most A2B genotypes belong to the A205/B allele in Taiwan. In this study, we report for the first time the presence of the A205, A201, and cis-AB02 alleles in Taiwan.

show abstract

“…7,8 The B 3 phenotype was found to be the most common subgroup in Taiwanese. [9][10][11][12] This study presents the molecular genetic analysis of 14 samples from unrelated Taiwanese individuals with the B 3 phenotype. …”

mentioning

confidence: 99%

Molecular genetic analysis for the B3allele

Twu

Chou

et al. 2002

Blood

View full text Add to dashboard Cite

Molecular genetic analysis of 14 samples from unrelated individuals with the B 3 phenotype is reported here. Two different molecular changes in the blood group B gene were observed. One case was demonstrated to possess a 247G 3 T mutation, which predicts an Asp83Tyr alteration. The B genes of the other 13 cases were shown to have a G 3 A mutation at the ؉5 nucleotide of intron 3 (intervening sequence 3 [IVS3] ؉ 5G 3 A). Reverse transcription polymerase chain reaction analysis showed that the complete exon 1-exon 7 B transcript was absent, and transcripts that skipped exon 3 were instead present in the RNA sample from the B 3 individual with the IVS3 ؉ 5G 3 A mutation. The result shows that the IVS3 ؉ 5G 3 A mutation destroys the conserved sequence of the splice donor site and leads to the skipping of exon 3 during messenger RNA processing. The IntroductionIn addition to the common ABO phenotypes, A 1 , A 2 , B, and O, numerous phenotypes with a weak expression of the A or B antigens on the red blood cells (RBCs) have been found. [1][2][3][4][5][6] The B 3 phenotype is characterized by mixed-field hemagglutination of RBCs with anti-B and anti-A-anti-B antibodies. Only limited results have been reported on the molecular genetic analysis of 4 B 3 cases so far. 7,8 The B 3 phenotype was found to be the most common subgroup in Taiwanese. [9][10][11][12] This study presents the molecular genetic analysis of 14 samples from unrelated Taiwanese individuals with the B 3 phenotype. Study designSequence analysis of the ABO gene and polymerase chain reaction-restriction fragment length polymorphism analysis Preparation of the genomic DNAs and the analysis of the 7 exon regions of the ABO genes were as described previously. 13 A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis was developed to demonstrate the intervening sequence-3 [IVS3] ϩ 5G 3 A mutation in the B gene, as the G 3 A change creates a BsmI site (GAATGC). We combined 100 ng genomic DNA and 15 pmol each forward (CGTACCTGCCTCGAGGCCTTGCAGCTTCAC) and reverse (CAGCAC-CCCGGCCAGCATGGATGCTCCAC) primer in 25 L PCR buffer containing 0.2 mM deoxynucleoside 5Ј-triphosphate and 0.5 U Taq polymerase. The PCR program included 5 minutes at 94°C followed by 30 cycles of 30 seconds at 94°C and 1 minute at 72°C. The PCR products were digested by BsmI enzyme and then analyzed by 3.5% agarose gel electrophoresis. Analysis of the ABO transcript structureTotal RNAs were prepared from peripheral blood cells. The complementary DNAs (cDNAs) were primed by oligodeoxythymidine primer, and 2 rounds of PCR amplification followed. The first PCR was performed with forward (TTGCGGACGCTGGCCGGAAAACCAAA, spanning the exon 1-2 junction of ABO cDNA) and reverse (TGTCCACGTCCACGCACACCAGG-TAATCCA, locating exon 7) primers. Products from the first PCR were amplified by nested forward (CAAAATGCCACGCACTTCGACCTAT-GATCC, locating exon 2) and reverse (CGCTCGCAGAAGTCACTGATC, locating exon 7) primers. The PCR conditions were similar to those described above, except that...

show abstract

The B₃ phenotype in Chinese

Cited by 14 publications

References 4 publications

Genetic and Mechanistic Evaluation for the Mixed-Field Agglutination in B3 Blood Type with IVS3+5G>A ABO Gene Mutation

Genetic and Mechanistic Evaluation for the Mixed-Field Agglutination in B3 Blood Type with IVS3+5G>A ABO Gene Mutation

Molecular basis of the A2B in Taiwan

Molecular genetic analysis for the B3allele

Contact Info

Product

Resources

About

The B3 phenotype in Chinese

Cited by 14 publications

References 4 publications

Genetic and Mechanistic Evaluation for the Mixed-Field Agglutination in B3 Blood Type with IVS3+5G>A ABO Gene Mutation

Genetic and Mechanistic Evaluation for the Mixed-Field Agglutination in B3 Blood Type with IVS3+5G>A ABO Gene Mutation

Molecular basis of the A2B in Taiwan

Molecular genetic analysis for the B3allele

Contact Info

Product

Resources

About

The B₃ phenotype in Chinese