The antidepressant-like effects of pioglitazone in a chronic mild stress mouse model are associated with PPARγ-mediated alteration of microglial activation phenotypes

Abstract

BackgroundDiscoveries that microglia-mediated neuroinflammation is involved in the pathological process of depression provided a new strategy for novel antidepressant therapy. Peroxisome proliferator-activated receptor γ (PPARγ) is a nuclear receptor regulating inflammation and microglial polarization and, therefore, a potential target for resolving depressive disorders. Our hypothesis was that antidepressant effects could be achieved through anti-inflammatory and neuroprotective activities by PPARγ-dependent microglia-modulating agents.MethodsChronic mild stress (CMS) treatment was performed on C57BL/6 mice for 6 weeks. After 3 weeks with the CMS procedure, depressive-like behaviors were evaluated by sucrose preference (SP), tail suspension test (TST), forced swimming test (FST), and locomotor activity. Pioglitazone was administered intragastrically once per day for 3 weeks at different doses. Neuroinflammatory cytokines were determined by real time-PCR (RT-PCR), enzyme-linked immunosorbent assay (ELISA), and western blot. The activated microglial state was confirmed by immunohistochemistry. N9 microglial cells were subjected to lipopolysaccharide, pioglitazone, and GW9662 to discuss the phenotype of activated microglia by RT-PCR, ELISA, and western blot.ResultsIt was demonstrated that the PPARγ agonist pioglitazone (2.5 mg/kg) ameliorated depression-like behaviors in CMS-treated mice, as indicated by body weight (BW), the SP test, the FST, and the TST. The amelioration of the depression was blocked by the PPARγ antagonist GW9662. The expression of M1 markers (IL-1β, IL-6, TNFα, iNOS, and CCL2) increased, and the gene expression of M2 markers (Ym1, Arg1, IL-4, IL-10, and TGFβ) decreased in the hippocampus of the stress-treated mice. Pioglitazone significantly inhibited the increased numbers and morphological alterations of microglia in the hippocampus, reduced the elevated expression of microglial M1 markers, and increased the downgraded expression of microglial M2 markers in C57BL/6 mice exposed to CMS. In an in vitro experiment, pioglitazone reversed the imbalance of M1 and M2 inflammatory cytokines, which is correlated with the inhibition of nuclear factor kB activation and is expressed in LPS-stimulated N9 microglial cells.ConclusionsWe showed that pioglitazone administration induce the neuroprotective phenotype of microglia and ameliorate depression-like behaviors in CMS-treated C57BL/6 mice. These data suggested that the microglia-modulating agent pioglitazone present a beneficial choice for depression.Electronic supplementary materialThe online version of this article (doi:10.1186/s12974-016-0728-y) contains supplementary material, which is available to authorized users.

Antagonizing peroxisome proliferator‐activated receptor γ facilitates M1‐to‐M2 shift of microglia by enhancing autophagy via the LKB1–AMPK signaling pathway

“…There is growing evidence suggesting that PPARγ can inhibit microglial activation, promote M2 polarization, and suppress inflammatory cytokines in inflammation‐related diseases, such as MS, EAE, Parkinson's disease (PD), stroke, and major depressive disorder (MDD) (Han et al., 2015; Kaiser et al., 2009; Mandrekar‐Colucci, Karlo & Landreth, 2012; Orihuela et al., 2016; Zhao et al., 2016). Our study also reveals that PPARγ activation could partly suppress LPS‐induced M1 activation, but it does not promote a resting M2 microglial phenotype (Figure S1).…”

“…Peroxisome proliferator‐activated receptor γ (PPARγ) is a ligand‐activated transcription factor that belongs to the nuclear receptor family and a master modulator of glucose and lipid metabolism, organelle differentiation, and inflammation (Guo et al., 2017; Zhao et al., 2016). These form heterodimers with the retinoid X receptor and bind to peroxisome proliferator response elements (PPREs) in the promoter region of respective target genes (Hallenborg et al., 2016).…”

The ketone body metabolite β‐hydroxybutyrate induces an antidepression‐associated ramification of microglia via HDACs inhibition‐triggered Akt‐small RhoGTPase activation

“…Briefly, 2 μl of diluted cDNA, 0.5 μM primers, 2 mM MgCl 2 and 1 x FastStart SYBR Green Master mix were employed. The primers for TNF‐α, IL‐β, IL‐10 and CD206 were as follows: TNF‐α (Huang et al, ): 5′‐CTG TGA AGG GAA TGG GTG TT‐3′ (F), 5′‐GGT CAC TGT CCC AGC ATC TT‐3′ (R); IL‐β: 5′‐TGG AAA AGC GGT TTG TCT TC‐3′ (F), 5′‐TAC CAG TTG GGG AAC TCT GC‐3′ (R) (Xu et al, ); CD206: 5′‐CTTCGGGCCTTTGGAATA AT‐3′ (F), 5′‐TAGAAGAGCCCTTGGGTTGA‐3′ (R) (Xu et al, ); IL‐10, 5′‐GGC AGA GAA CCA TGG CCC AGA A‐3′ (F), 5′‐AAT CGA TGA CAG CGC CTC AGC C‐3′ (R) (Zhao et al, ). PCR products were detected by monitoring the fluorescence increase of double‐stranded DNA‐binding dye SYBR Green during amplification.…”

How to reprogram microglia toward beneficial functions

“…The treatment of AD mice with the PPAR‐γ agonist pioglitazone, a drug used to treat type 2 diabetes, results in enhanced capability of microglia to phagocyte Aβ (Yamanaka et al, ) and cognitive improvement. Moreover, pioglitazone ameliorates the disease course in both the experimental autoimmune encephalomyelitis (EAE) model of MS (Feinstein et al, ; Storer, Xu, Chavis, & Drew, ) and in mice subjected to chronic mild stress (Q. Zhao et al, ).…”