The 50 kDa metalloproteinase TvMP50 is a zinc-mediated Trichomonas vaginalis virulence factor

Trichomonicidal activity of a new anthraquinone isolated from the roots of Morinda panamensis Seem

“…Therefore, we assumed that the inhibition of these proteases would be an important aspect in the search of new antitrichomonal agents. In this work, we demonstrate that lucidin‐ω‐isopropyl ether is capable of inhibiting proteolytic activity of TvMP50 (Figure a), which is an active metalloproteinase that was characterized by assaying cytotoxicity toward prostatic cell monolayers (Puente‐Rivera et al, ). These results clearly suggest that lucidin‐ω‐isopropyl ether represents a potent TvMP50 inhibitor, which is supported by an inhibition at the genetic level (Figure b).…”

“…Because lucidin‐ω‐isopropyl ether treatment of T. vaginalis suppressed cytotoxicity, it was important to examine whether the decreased cell damage seen, resulted from the reduction of TvMP50 activity, an important metalloproteinase of T. vaginalis with cytolytic effect (Puente‐Rivera et al, ). Initially, the TvMP50 proteolytic activity was analyzed by zymograms.…”

“…HeLa cell monolayers (4 × 10 4 cells/well) were grown in 96‐well plates, then incubated with 2 × 10 5 T. vaginalis trophozoites (5:1 parasite–host cell ratio) grown with 5 and 10 μg/mL of the A7.4.5 + SPE‐2 compound or the vehicle (0.01% DMSO), and then incubated for 20 and 40 min at 37°C in a 5% CO 2 atmosphere. Damage to the HeLa monolayer was quantified using a colorimetric assay, as described previously (Alvarez‐Sánchez et al, ; Puente‐Rivera et al, ).…”

“…To examine the expression profile of target genes, semi‐quantitative reverse transcription polymerase chain reaction was performed using 0.2 μL of the cDNA preparation as a template. The mp50 primers: mp50‐forward (5′‐CGACTGGGACTGGGCTTTGAAACTCG‐3′) and mp50‐reverse (5′‐TCAAAGTACTCTTGAAGC‐3′) were used (Puente‐Rivera et al, ). In addition, a 112‐bp fragment of the β‐ tubulin gene was used as a loading control.…”

“…Many cysteine proteinases have been involved as prevalent virulence factors in T. vaginalis , including metalloproteinases. Recently, the metalloproteinase TvMP50 was described as a new secreted virulence factor in this parasite and that participates in the cytotoxicity to the host cell (Puente‐Rivera et al, ). The cysteine proteinases from diverse parasites are a promising group for the development of new antiparasitic chemotherapy.…”