Tet system in the brain: Transgenic rats and lentiviral vectors approach

Abstract

Local and regulated expression of exogenous genes in the central nervous system is one of the major challenges of modern neuroscience. We have approached this issue by applying the inducible tetracycline system to regulate the expression of EGFP reporter gene in double transgenic rats. We have obtained a strong induction of EGFP only in male testes, which correlated with a high level of rtTA expression only in this organ. To overcome the problem of lack of rtTA protein in the transgenic rat brain, we have delivered this Tet system activator with lentiviral vectors into the dentate gyrus of hippocampus of transgenic EGFP rats. As a result, after systemic application of doxycycline we have obtained inducible, stable and restricted to the desired brain region expression of EGFP. An advantage of this strategy is that the transgene is located in the same genetic milieu in every cell of the transgenic organism. This is crucial to obtain uniform expression of the regulated gene within the target brain structure. Combination of rat transgenesis and lentiviral vectors is a novel approach enabling precise spatiotemporal regulation of genes of interest strictly in the brain structure of choice or in other tissues.

Light-sheet microscopy imaging of a whole cleared rat brain with Thy1-GFP transgene

“…The fertilized embryos were obtained from superovulated Wistar rats and the standard pronuclear microinjection was performed. The embryos were then transferred to the foster mothers, as described previously2627. Genotypes of obtained offspring were determined by PCR using the following primers: Thy1_F (TCTGAGTGGCAAAGGACCTTAGG) and GFP_R (CACGAACTCCAGCAGGACCATG).…”

Generation and characterization of a Tet-On (rtTA-M2) transgenic rat

“…Early this year, three groups have reported generating transgenic rats by driving TetR expression with the chicken β-actin or ubiquitin promoters [38,41] or tTA by the chicken β-actin promoter [40]. In addition, Konopka and coworkers [39] generated a "Tet-On" transgenic rat in which rtTA is driven by the EF1α promoter. The EF1α promoter is typically expected to cause ubiquitous expression, but functional rtTA expression (indicated by activation of a TetO/CMV-EGFP reporter) was limited to the testis in that study.…”

“…To date, over 100 different tetracycline-regulated transgenic mouse lines have been described (reviewed at the Tetmouse Base, http://www.zmg.uni-mainz.de/tetmouse/index.htm). In contrast, only a few rat lines have been generated, expressing either tTA [36-38] or rtTA [39]. To facilitate loss-of-function studies, two conditional (inducible) transgenic rats have been described in which TetR/TetO system is employed to regulate expression of an shRNA [40,41].…”

WP1: transgenic opto-animals

“…This gives us a very stable expression of a transgene in the same genetic milieu of targeted cells. A second element of the system Tet or Cre dependent opsin construct is then delivered to the specified brain region via more versatile viral vector approach [12,13,14].…”