Telomere shortening associated with increased levels of oxidative stress in sulfur mustard-exposed Iranian veterans

Abstract

Mahdi (2018) Telomere shortening associated with increased levels of oxidative stress in sulfur mustard-exposed Iranian veterans. Mutation Research/Genetic Toxicology and Environmental Mutagenesis, 834. pp. 1-5.

Occupational Exposures and Environmental Health Hazards of Military Personnel

“…Additionally, the length of telomeres in leukocytes and p16 INK4a mRNA expression were investigated as biomarkers for cellular senescence. Length of telomeres in leukocytes was shown to be significantly shorter in exposed veterans than in non-exposed controls, in line with data reported by Behravan et al [ 34 ]. The expression level of p16 INK4a was lower in exposed compared to non-exposed subjects, indicating an impaired immune system and cellular senescence [ 33 ].…”

“…Other studies investigated lipid peroxidation derivative malondialdehyde (MDA) levels as an oxidative stress measure in serum, and 8-oxo-dG genomic DNA content and OGG1 expression as biomarkers for oxidative damage in 215 veterans, at 25 years after exposure [ 13 , 33 ]. Increased MDA levels indicated oxidative stress in poisoned subjects, confirming the results of a historical cohort investigation by Behravan et al [ 34 ] on 40 veterans who showed increased serum levels of 8-isoprostane F2-alpha. Behboudi and colleagues [ 33 ] demonstrated that 8-oxo-dG and OGG1 mRNA expression levels were increased, when compared to a control group, indicating a higher oxidative damage in SM-exposed veterans.…”

Chronic senescent human mesenchymal stem cells as possible contributor to the wound healing disorder after exposure to the alkylating agent sulfur mustard

“…7 2012). Moreover, first hints of senescence are described as reduced telomere length in SM exposed Iranian veterans (Behboudi et al 2018;Behravan et al 2018) and our group has already discovered acute senescence after SM treatment (Schmidt et al 2018a). Concluding that the blisterinducing concentration of SM is about 150 µM (Smith et al 1993) and only 16% reaches the circulation (Cullumbine 1947), this would result in low plasma levels.…”

“…Since senescence was already shown to be induced by unresolved DNA damage (Sedelnikova et al 2004 ) or RO S (von Zglinicki 2002 ), it is not surprising that SM also leads to senescence, as it results in various DNA and RNA mono-alkylation adducts and crosslinks (Zubel et al 2019 ) as well as the formation of oxygen free radicals (Brimfield et al 2012 ). Moreover, first hints of senescence are described as reduced telomere length in SM exposed Iranian veterans (Behboudi et al 2018 ; Behravan et al 2018 ) and our group has already discovered acute senescence after SM treatment (Schmidt et al 2018a ). Concluding that the blister-inducing concentration of SM is about 150 µM (Smith et al 1993 ) and only 16% reaches the circulation (Cullumbine 1947 ), this would result in low plasma levels.…”

Evaluation of the effect of thymoquinone in d‐galactose‐induced memory impairments in rats: Role of MAPK, oxidative stress, and neuroinflammation pathways and telomere length

“…ABI (ABI, USA). The primer sequences were: Tel; Forward 5′‐CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTT‐3′ and Reverse:5′‐GGCTTGCCTTACCCTTACCCTTACCCTTACCCT‐3′ and the 36B4 Forward:5′‐ACTGGTCTAGGACCCGAGAAG‐3′ and Reverse: 5′‐TCAATGGTGCCTCTGGAGATT‐3′ (Asok, Bernard, Rosen, Dozier, & Roth, 2014; Behravan et al, 2018). Real‐time PCR was performed with the Step One Plus Real‐time PCR system (Applied Biosystems, USA).…”