Targeting 11q23 positive acute leukemia cells with high molecular weight-melanoma associated antigen-specific monoclonal antibodies

Drake, Allison; Brady, Michael T.; Wang, Xin Hui; Sait, Sheila; Earp, Justin; Ghoshal, Sampa; Ferrone, Soldano; Wang, Eunice S.; Wetzler, Meir

doi:10.1007/s00262-008-0567-5

Cited by 13 publications

(11 citation statements)

References 39 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The primers which were utilized for genomic PCR and sequencing were: JAK2 V617F , forward, 5′ TGAAGCAGCAAGTATGATGAGC3′ and reverse, 5′ ACCTAGCTGTGATCCTGAAACTG3′; JAK2 T875N , forward, 5′ GGTAATTTTGGGAGTGTGGAGA3′, AND REVERSE, 5′ AGCTTACCAGCACTGTAGCACAC3′; MPL W515L/K , forward, 5′ AAGTCTGACCCTTTTTGTCTCCT3′, reverse, 5′ GAGGTGACGTGCAGGAAGTGG3′. PCR was conducted as previously described [22]. …”

Section: Methodsmentioning

confidence: 99%

Myeloid blastic transformation of myeloproliferative neoplasms—A review of 112 cases

et al. 2011

Self Cite

View full text Add to dashboard Cite

Blastic transformation of myeloproliferative neoplasms (MPN) is still poorly understood. We describe a cohort of 23 Roswell Park Cancer Institute (RPCI) patients and 89 additional cases from the English literature for whom biologic features were described. We initially compared our 23 patients to the 89 cases from the literature. Our population had significantly less patients with prior history of polycythemia vera (PV), shorter time from MPN diagnosis to blastic transformation, <3 prior therapies, more frequent use of hydroxyurea and erythropoietin and less frequent use of alkylating agents. Interestingly, the overall survival of the two cohorts from the time of blastic transformation was similar. We therefore looked at the outcome of the entire cohort (n=112). Patients with prior history of essential thrombocythemia survived longer than patients with prior history of myelofibrosis or PV. Further, patients with <3 prior therapies, those who lacked complex karyotype and those <60 year old at MPN diagnosis had significantly longer survival. Among the PRCI population, 20/23 patients underwent induction treatment with cytarabine and an anthracycline containing regimens; 12 achieved remission and their overall survival was significantly longer than those who did not. Three patients underwent an allogeneic transplantation and their survival was significantly longer than those who did not. Patients with <3 prior therapies, those who lack complex karyotype and those <60 at MPN diagnosis have longer survival following blastic transformation. Finally, allogeneic transplantation represents the only chance for long-term survival in these patients.

show abstract

Section: Methodsmentioning

confidence: 99%

Myeloid blastic transformation of myeloproliferative neoplasms—A review of 112 cases

et al. 2011

Self Cite

View full text Add to dashboard Cite

show abstract

“…The cDNA was used as a template in a PCR reaction to amplify different HSP 70s and the housekeeping gene actin. The reaction was performed as previously described [13]. The primers are described in Table 1.…”

Section: Methodsmentioning

confidence: 99%

Down-regulation of heat shock protein 70 improves arsenic trioxide and 17-DMAG effects on constitutive signal transducer and activator of transcription 3 activity

Ghoshal

Rao

Earp

et al. 2009

Cancer Chemother Pharmacol

Self Cite

View full text Add to dashboard Cite

Purpose Signal transducer and activator of transcription 3 (STAT3) has been shown to be constitutively active in approximately 50% of patients with acute myeloid leukemia and is associated with worse outcome. Arsenic trioxide (ATO) synergizes with the heat shock protein (HSP) 90 inhibitor, 17-DMAG, to down-regulate STAT3 activity. However, both agents up-regulate HSP70, an anti-apoptotic protein. We therefore examined whether down-regulating HSP70 with short interference (si) RNA will affect ATO and 17-DMAG effects on constitutive STAT3 activity. Experimental design A semi-mechanistic pharmacodynamic model was used to characterize concentration–effect relationships of ATO and 17-DMAG effects on constitutive STAT3 activity and HSP70 expression with or without siRNA against HSP70 in a cell line model. Results Treatment with siRNA for HSP70 resulted in a stronger degree of synergism on down-regulation of STAT3 activity by ATO and 17-DMAG. However, treatment with siRNA for HSP70 resulted in less synergism on up-regulation of HSP70 by the two drugs. Conclusions Down-regulation of HSP70 improves ATO and 17-DMAG effects on constitutive STAT3 activity. These results further provide a basis for studying the combined role of ATO with a HSP90 inhibitor such as 17-DMAG in AML with constitutive STAT3 activity.

show abstract

“…However, they leave veiled several biological and clinical questions, including the biological significance of the NG2/CSPG4 expression on discrete leukemic cells and the therapeutic potential of this selective expression. The negative outcome of the experimental targeting of a model leukemic cell line with two anti-NG2/CSPG4 antibodies 105 , independently validated as effective tools for abrogating growth and dissemination of solid tumour xenografts ( see below ), reinforces these uncertainties. In parallel, in a recent publication Petrovici et al 106 , reported some AML cases manifesting a normal karyotype, while, concurrently, a significant amount of the leukemic cells expressed NG2/CSPG4.…”

Section: Dismally Fated Leukemic Patients De Novo Express Ng2/cspg4 mentioning

confidence: 99%

“… 1 As established by flow cytometry using the reference mAb 7.1; 2 Adopted average cut-off was >25% of leukemic blasts; 3 NG2/CSPG4 expression has also been documented in one case of DC2/NK cell ALL 105 ; Abbreviations : NS = not specified; ND = not determined. …”

Section: Figurementioning

confidence: 99%

Theranostic Impact of NG2/CSPG4 Proteoglycan in Cancer

Nicolosi¹,

Dallatomasina²,

Perris³

2015

Theranostics

View full text Add to dashboard Cite

NG2/CSPG4 is an unusual cell-membrane integral proteoglycan widely recognized to be a prognostic factor, a valuable tool for ex vivo and non-invasive molecular diagnostics and, by virtue of its tight association with malignancy, a tantalizing therapeutic target in several tumour types. Although the biology behind its involvement in cancer progression needs to be better understood, implementation of NG2/CSPG4 in the routine clinical practice is attainable and has the potential to contribute to an improved individualized management of cancer patients. In this context, its polymorphic nature seems to be particularly valuable in the effort to standardize informative diagnostic procedures and consolidate forcible immunotherapeutic treatment strategies. We discuss here the underpinnings for this potential and highlight the benefits of taking advantage of the intra-tumour and inter-patient variability in the regulation of NG2/CSPG4 expression. We envision that NG2/CSPG4 may effectively be exploited in therapeutic interventions aimed at averting resistance to target therapy agents and at interfering with secondary lesion formation and/or tumour recurrence.

show abstract

Targeting 11q23 positive acute leukemia cells with high molecular weight-melanoma associated antigen-specific monoclonal antibodies

Cited by 13 publications

References 39 publications

Myeloid blastic transformation of myeloproliferative neoplasms—A review of 112 cases

Myeloid blastic transformation of myeloproliferative neoplasms—A review of 112 cases

Down-regulation of heat shock protein 70 improves arsenic trioxide and 17-DMAG effects on constitutive signal transducer and activator of transcription 3 activity

Theranostic Impact of NG2/CSPG4 Proteoglycan in Cancer

Contact Info

Product

Resources

About