Systematic improvement of isobutanol production from d-xylose in engineered Saccharomyces cerevisiae

Abstract

As the importance of reducing carbon emissions as a means to limit the serious effects of global climate change becomes apparent, synthetic biologists and metabolic engineers are looking to develop renewable sources for transportation fuels and petroleum-derived chemicals. In recent years, microbial production of high-energy fuels has emerged as an attractive alternative to the traditional production of transportation fuels. In particular, the Baker’s yeast Saccharomyces cerevisiae, a highly versatile microbial chassis, has been engineered to produce a wide array of biofuels. Nevertheless, a key limitation of S. cerevisiae is its inability to utilize xylose, the second most abundant sugar in lignocellulosic biomass, for both growth and chemical production. Therefore, the development of a robust S. cerevisiae strain that is able to use xylose is of great importance. Here, we engineered S. cerevisiae to efficiently utilize xylose as a carbon source and produce the advanced biofuel isobutanol. Specifically, we screened xylose reductase (XR) and xylose dehydrogenase (XDH) variants from different xylose-metabolizing yeast strains to identify the XR–XDH combination with the highest activity. Overexpression of the selected XR–XDH variants, a xylose-specific sugar transporter, xylulokinase, and isobutanol pathway enzymes in conjunction with the deletions of PHO13 and GRE3 resulted in an engineered strain that is capable of producing isobutanol at a titer of 48.4 ± 2.0 mg/L (yield of 7.0 mg/g d-xylose). This is a 36-fold increase from the previous report by Brat and Boles and, to our knowledge, is the highest isobutanol yield from d-xylose in a microbial system. We hope that our work will set the stage for an economic route for the production of advanced biofuel isobutanol and enable efficient utilization of lignocellulosic biomass.

Isobutanol production by Candida glabrata – A potential organism for future fuel demands

“…There are no reports on the production of isobutanol by native Candida sp. Several studies have been done on the production of isobutanol by genetically modified strains of Saccharomyces [25,[27][28][29] . The native biosynthesis level of isobutanol in yeast is very low and the current maximum isobutanol production with S. cerevisiae is still far below the theoretical yields of 410 mg/g glucose [25,30].Hence there is a need for genetic modification approaches to improve the butanol isomers [31][32][33][34].…”

Increased production of isobutanol from xylose through metabolic engineering of Saccharomyces cerevisiae overexpressing transcription factor Znf1 and exogenous genes

“…In summary, we have engineered yeast strain ZNXISO by overexpression of ZNF1 in the selected strain with XR–XDH variants, the xylose-specific sugar transporter, xylulokinase, and enzymes in the isobutanol pathway that produced 16.9 ± 1.9 mg/L of isobutanol (Promdonkoy et al 2019 ) to 112 mg/L of isobutanol. Addition of iron and upscale production further enhance the production by ZNXISO to the highest isobutanol titer of 14.809 ± 0.400 g/L, 148 mg isobutanol/g xylose consumed and isobutanol productivity 34.98 mg/g CDW/h (+264.75% yield improvement).…”

“…The primers ZNF1 -5_ BamH I AAGTAAAAGAGCTCTGGATCCACCATGGCCCGCAATAGAC and ZNF1 -3_ Sal I GCAAGTAGCAATGTGTCGACTTAAGGAAGCGCATCTACATC were used for construction (Jensen et al 2019 ). The empty plasmid pRS316 or pLJ529- ZNF1 was transformed into the S. cerevisiae PWY2343 strain, which harbors the isobutanol pathway cassette (Promdonkoy et al 2019 ) using the LiAc/SS carrier via the PEG method (Gietz and Schiestl 2007 ). Colonies were selected on synthetic complete dropout without uracil (SD −ura )(Sigma) plates supplemented with 20 g/L glucose as the carbon source ( Table S1 , Supporting Information ).…”

“…Previously, overexpressing ZWF1 gene contributes to increased isobutanol titers by resolving cofactor imbalance, resulting in 11.46 mg isobutanol/g glucose or 1.82-fold increase in titers when compared with the parental strain (Feng et al 2017 ). Isobutanol titer is also improved to 16.9 ± 1.9 mg/L by overexpressing of XR–XDH genes, encoding a xylose-specific sugar transporter, xylulokinase, and enzymes of the isobutanol pathway in conjunction along with deleting of PHO13 and GRE3 genes, representing a 17-fold increase when compared to the wild-type strain (Promdonkoy et al 2019 ).…”

Biorefinery: The Production of Isobutanol from Biomass Feedstocks

“…E. coli and S. cerevisiae are the most promising cellulosic isobutanol-producing strains. Two model organisms have invested considerable research in cellulose utilization, which have been summarized in a considerable number of reviews [74,75]. They both have significant carbon catabolite repression and cannot utilize glucose simultaneously with other sugars.…”