Syphilis epidemiology in 1994–2013, molecular epidemiological strain typing and determination of macrolide resistance in Treponema pallidum in 2013–2014 in Tuva Republic, Russia

Abstract

The incidence of syphilis in the Tuva Republic (geographical centre of Asia), Russia has been exceedingly high historically. No detailed examinations and no molecular investigations of Treponema pallidum strains transmitted in the Tuva Republic, or in general, in Russia, were published internationally. We examined the syphilis epidemiology in 1994-2013, and the molecular epidemiology and macrolide resistance in T. pallidum strains in 2013-2014 in the Tuva Republic. Among 95 mainly primary or secondary syphilis patients, the arp, tpr, tp0548 and 23S rRNA genes in 85 polA gene-positive genital ulcer specimens were characterized. The syphilis incidence in Tuva Republic peaked in 1998 (1562), however declined to 177 in 2013. Among the 70 (82%) completely genotyped specimens, six molecular strain types were found. Strain type 14d/f accounted for 91%, but also 14c/f, 14d/g, 14b/f, 14i/f, 9d/f, and 4d/f were identified. Two (2.4%) specimens contained the 23S rRNA A2058G macrolide resistance mutation. This is the first internationally published typing study regarding T. pallidum in Russia, performed in the Tuva Republic with the highest syphilis incidence in Russia. The two molecular strain types 4d/f and 9d/f have previously been described only in Eastern and Northern China and for the first time, macrolide-resistant syphilis was described in Russia.

Enhanced molecular typing of Treponema pallidum identified a new tp0548 Gene type in Shandong, China

“…1) (CAGGCGGCAGTGGCCACAGCCGCTGGAG GGTCCAGTGGTCGCAGCGATAATGGCAAC CACCCCGGCAAGGAACAGTTTCTCCAGTT) that was designated type "o". Most strains (31/ 47; 66%) belonged to subtype 14d/f, which is consistent with the findings of study in Tuva Republic, Russia (8).…”

Circulation of Distinct Treponema pallidum Strains in Individuals with Heterosexual Orientation and Men Who Have Sex with Men

“…In contrast to the MSM population, T. pallidum genotype diversity was limited in the heterosexual population in both males and females. The dominant genotype associated with female patients in our study was 14d/f, a genotype frequently identified around the globe, including in China (19,44,45), Peru (46), Russia (47), and the United States (19). It was assumed that certain T. pallidum subsp.…”

Syphilis, hepatitis C and HIV in Eastern Europe

“…The first molecular epidemiological study of syphilis in EE was recently conducted, in the Tuva Republic, in southern Siberia: the authors estimated an incidence rate of 177 per 100,000 in 2013 and demonstrated that the 14d/f T.pallidum strain caused 91% of the syphilis cases [64]; this study also reported a 2.4% prevalence of macrolide-resistance (23S rRNA A2058G). A recent report from the Czech Republic has documented a substantial increase in macrolide-resistant strains (A2058G and A2059G 23S rRNA) over time [65,66], consistent with findings from elsewhere in Europe and globally [67].…”