Synthetic sites for transcription termination and a functional comparison with tryptophan operon termination sites in vitro.

Abstract

Termination of transcription by Escherichia coli RNA polymerase in vitro appears to depend primarily on two structural features of the termination site-a G+C-rich region of dyad symmetry and a series of terminal uridine residues in the transcript. To determine whether these two features are sufficient to specify p-independent termination in vitro, we have introduced new sequences within a tryptophan (trp) operon structural gene to create two sites with these characteristics. Transcription with wild-type RNA polymerase in vitro demonstrates that discrete termination occurs at one of these new sites, although at a low level. Use of the mutant RNA polymerase rpo203, which is more sensitive to certain weak terminators than is the wild-type enzyme, increases termination at both sites. We have compared the activity ofour synthetic terminators with those ofseveral termination sites in the E. coli trp operon. Under normal conditions of transcription in vitro, termination becomes more efficient with an increase in the length of the stem in the RNA hairpin or an increase in the number of consecutive uridine residues. Transcription with the rpo203 polymerase and with ribonucleotide analogs gives changes consistent with these general trends. These results support a model for termination involving separate but essential roles for the RNA hairpin and the stretch of uridines in the transcript.Termination of transcription by Escherichia coli RNA polymerase generally occurs at specific sites on a DNA template. Although termination is modulated by the transcription termination factor p in vivo (1), many terminators function in vitro in the absence of p. Sequence comparison of p-independent termination sites reveals common features (2, 3). These include a G+C-rich region of dyad symmetry, which can result in an RNA hairpin, and a series of terminal uridine residues in the transcript immediately 3' to the region of dyad symmetry. Our studies have suggested that these two features reflect the involvement of both RNA-RNA and RNA-DNA interactions in termination at p-independent sites (4). The presumed role of the RNA hairpin in inducing a pause by RNA polymerase is supported by experimental evidence (2,5,6). The extreme instability ofrU-dA base-pairing (7) probably enhances the release ofthe nascent transcript at the run ofuridines. According to our model, the balance between elongation and dissociation ofRNA polymerase at a termination site depends on the potential stability of the RNA hairpin and the weakness of the interaction between the terminal region ofthe transcript and the template.Results obtained by varying conditions of transcription in vitro are consistent with this model. Termination can be affected not only by nucleotide sequence, but also by the nature of the incorporated ribonucleotides and the RNA polymerase (4, 8-10). Our previous studies have focused on the trp attenuator termination site (trp a) as a model system. Removal offour of the eight terminal uridine residues from this site by the deletion trp a14...

The use of a tRNA as a transcriptional reporter: the T7 late promoter is extremely efficient inEscherichia colibut its transcripts are poorly expressed

“…The former is moderately efficient upon T7 RNA polymerase (28), whereas the second is very efficient upon the E. coli RNA polymerase (12) and moderately so upon the T7 enzyme (28).…”

“…The ClaI site lying 93 nt upstream of the BstBl site was then filled in, shifting the lacY translation into the -1 reading frame and causing translation termination 88 nt upstream of the tRNA gene. Next, the synthetic sequence 5' TAGCCCGCCTAATGAGCGGGCTTTTTTTT 3' encompassing the trpA terminator (12) was inserted in the XbaI site immediately downstream of the T7 terminator. The extremities of this fragment were so designed that only one XbaI site is regenerated downstream of the terminator.…”

A specific DNA sequence controls termination of transcription in the gastrin gene.

“…On the basis of our deletion mutagenesis results, the yeast sequence may be too short to have a 3' transcriptional regulatory function in higher eucaryotes. In procaryotes, a hairpin loop followed by 8 to 10 thymidylates is a general feature of factor-independent terminator (7,13,23), but no such feature is found in the gastrin gene regulatory sequence. In the factor-dependent terminator in procaryotes, no common feature has been identified, except that the termination seems to occur on a specific sequence (23).…”

Balanced branching in transcription termination

“…Many other researchers report similar values for terminators in E. coli and other bacteria (9), including artificially altered terminators (10). The results in Tables 2 and 3 show balanced termination for modified versions of the phage terminator tR2 (11) and for mutant polymerase (12). These modifications make order-1 changes to the efficiencies themselves.…”