Synergistic hemolysis exhibited by species of staphylococci

Abstract

The synergistic hemolysis reactions of 61 reference strains and 189 clinical isolates representing 17 species of staphylococci were examined on plates of Trypticase soy blood agar (BBL Microbiology Systems, Cockeysville, Md.). Some or all of the strains of Staphylococcus aureus, S. epidermidis, S. capitis, S. cohnii, S. haemolyticus, S. hyicus, S. simulans, S. warneri, and S. xylosus produced a delta-hemolysin that gave synergistic, complete hemolysis of washed human, sheep, and ox blood cells in an area of beta-lysin activity from strains of S. aureus and S. intermedius. Strains of the same nine species were positive with a commercial beta-lysin paper disk designed for presumptive identification of group B streptococci; most of these strains also gave synergistic, complete hemolysis with exotoxin from a strain of Corynebacterium pseudotuberculosis. None of the strains of S. auricularis, S. carnosus, S. caseolyticus, S. hominis, S. intermedjus, S. saprophyticus, S. sciuri, or S. lentus were positive by any of these tests for synergistic hemolysis. These results indicate that a synergistic hemolysis test could prove very useful for differentiating these species; they also suggest that one role of some of these organisms in human infections could be that of a synergist. Further studies of synergism may clarify the clinical significance of these results.

Staphylococcus epidermidis is cleared from biomaterial implants but persists in peri‐implant tissue in mice despite rifampicin/vancomycin treatment

“…The study was performed with S. epidermidis strain AMC5, a clinical isolate causing persistent infection in the mouse model. 19 AMC5 produces slime, as determined by the method of Christensen, 22 d-toxin as determined according to Hebert and Hancock, 23 and is positive for the biofilm-associated icaA, atlE, sarA, and aap genes by PCR. Primers for icaA, atlE, and aap were according to Vandecasteele et al 24 sarA was detected using primers sarA_d (AGCAAATGCTACATTGCTAATTC) and sarA_r (ATT-TGCTTCTGTGATACGGTTG).…”

Evaluation of Two Commercial Systems and a New Identification Scheme Based on Solid Substrates for Identifying Coagulase‐Negative Staphylococci from Bovine Mastitis

“…All of the tests were performed on agar plates where nine test strains on each agar plate were inoculated as a short streak or a spot. Staphylococcus hyicus is known to cause a unique haemolysis in the b-toxin zone of S. intermedius (Hébert and Hancock, 1985;Lämmler, 1991). The method was slightly modified by the use of unwashed bovine blood (Birgersson et al, 1994).…”

The amino acid sequences and activities of synergistic hemolysins fromStaphylococcus cohnii

“…Coagulase-negative staphylococci (CoNS) rarely produce a or b hemolysin (Hebert, 1990;Molnar et al, 1994). On the other hand, d-toxin, which can be detected by a simple test of synergistic hemolysis (Christie, Atkins, Munch and Petersen test, CAMP), was found in most species of CoNS (Bhakdi, 1985;Hebert & Hancock, 1985;Hebert et al, 1988;Gemmell, 2002).…”