Study of disease-relevant polymorphisms in the TLR4 and TLR9 genes: A novel method applied to the analysis of the Portuguese population

Abstract

Toll-like receptors (TLRs) are cellular receptors that mediate recognition of microbial challenges and the subsequent inflammatory response. Genetic variations within these inflammation-associated genes may alter host-pathogen defence mechanisms affecting susceptibility towards infectious diseases. Taking into account the significance of these genes, we developed a simple and rapid method based in the bi-directional PCR amplification of specific alleles (Bi-PASA) for genotyping known sequence variants in TLR4 (Asp299Gly and Thr399Ile) and TLR9 (T-1237C) genes. This method allows genotype determination in a single reaction and is amenable to largescale analysis. We used Bi-PASA to characterize the distribution of these polymorphisms in the Portuguese population. A total of 388 randomly selected blood donors of Portuguese origin (203 females and 185 males) were genotyped and allele frequencies were determined. Among the tested individuals, 11.1% and 10.8% were heterozygous for Asp299Gly and Thr399Ile, respectively. In what concerns the T-1237C variation in TLR9, the variant allele was present in 19.4% of the individuals tested. Besides confirming the usefulness of the Bi-PASA in polymorphism analysis, the data presented provide valuable information on TLR polymorphisms in the Portuguese population that can be used to stratify risk patients with increased susceptibility to infection. r

TLR4 inactivation protects from graft-versus-host disease after allogeneic hematopoietic stem cell transplantation

“…IL-17 expression is related to a third subset of T cells and plays a critical role in the extracellular pathogen response, which may lead to inflammation and is also related to severe autoimmune diseases. 15 In summary, our results indicated that TLR4 gene deficiency keeps DCs in an immature state where they do not express high levels of CD80, CD86, CD40 or MHC-II, and their IL-12 secretion is blocked. This, in turn, leads to reduced CD4 1 T-cell maturation into Th1 phenotypes.…”

“…14 Other studies have shown the incidence of being a TLR4 Asp299Gly and Thr399Ile carrier (including homozygotes and heterozygotes) worldwide lies in the range of 2.5%-20.7%. [15][16][17][18][19] The TLR4 Asp299Gly polymorphism, in particular, is the highest in African Americans, while in a western Iran population, the highest incidence for a mutation was found for the TLR4 Thr399Ile polymorphism, which is in, contrast, very rare in Asian populations, such as those in Japan and South Korea. 20,21 Carriers of the Thr399Ile TLR4 gene mutation have a significantly increased risk of developing GVHD, 42% versus 15% of non-affected patients, whereas transplant-related mortality, overall survival rate and the incidence of infectious complications are not influenced by the mutated gene.…”

Lack of association of TLR4 gene Asp299Gly and Thr399Ile polymorphisms with rheumatoid arthritis in Chinese Han population of Yunnan Province

“…The population studies have revealed a speciWc geographical (ethnic) distribution of the TLR4 Asp299Gly and (or) Thr399Ile haplotypes. The African have the highest frequency of these two polymorphisms of about 16% [26], followed by Caucasian White with the frequency of 4-10% [27][28][29][30][31][32][33], and Asian populations show a complete absence of Asp299Gly and Thr399Ile. Our study, together with reports from other authors, suggests a possibility that these two polymorphisms, widely reported in African and Caucasians, do not occur among Asian populations.…”

Dectin-1 Y238X polymorphism associates with susceptibility to invasive aspergillosis in hematopoietic transplantation through impairment of both recipient- and donor-dependent mechanisms of antifungal immunity

“…13,14 Genotyping was performed using bidirectional polymerase chain reaction (PCR) amplification of specific alleles (Bi-PASA), as previously described. 18 The PCR primers used were as follows: P1, GTAGTCCCAGCTACTTGAGG; P2, ACCACTTGAGAT-TCACAACA; P3, ggcggcggggAGTGTGCCCTCATAT; and P4, gggccgggggTTCTTCTCACAAATACTC. Allele and genotype frequencies of the DECTIN1 Y238X polymorphism were similar to those observed in the National Center for Biotechnology Information database and comparable between donors and recipients (data not shown).…”