2020
DOI: 10.1590/s1984-29612020012
|View full text |Cite
|
Sign up to set email alerts
|

Spotted fever group rickettsial infection in dogs and their ticks from domestic–wildlife interface areas in southeastern Brazil

Abstract: Rickettsia rickettsii is the causative agent of Brazilian spotted fever (BSF), for which humans and dogs are both susceptible. Dogs are sentinels in serological surveys, however, canine disease is rarely reported. Therefore, we aimed to evaluate natural infection by spotted fever group (SFG) Rickettsia spp. in dogs and ticks collected from domiciles close to forest fragments, featuring domestic–wildlife interface areas. Samples from 115 dogs and 135 ixodids were assessed by polymerase chain reactions (PCR) tar… Show more

Help me understand this report

Search citation statements

Order By: Relevance

Paper Sections

Select...
2
1
1
1

Citation Types

0
2
0
3

Year Published

2020
2020
2022
2022

Publication Types

Select...
4

Relationship

1
3

Authors

Journals

citations
Cited by 4 publications
(5 citation statements)
references
References 34 publications
(51 reference statements)
0
2
0
3
Order By: Relevance
“…It should be noted that the distribution data for A. ovale in the Brazilian Atlantic Forest biome suggests this species is more prevalent in the states of São Paulo, Bahia, and Paraná (Vieira et al, 2013;Nieri-Bastos et al, 2018;Fournier et al, 2020). Furthermore, in the state of Rio de Janeiro, studies have shown that the frequency of parasitism by A. ovale in dogs tends to be low or even zero (Santos et al, 2013;Cordeiro et al, 2015;Campos et al, 2020).…”
Section: Variablementioning
confidence: 99%
See 1 more Smart Citation
“…It should be noted that the distribution data for A. ovale in the Brazilian Atlantic Forest biome suggests this species is more prevalent in the states of São Paulo, Bahia, and Paraná (Vieira et al, 2013;Nieri-Bastos et al, 2018;Fournier et al, 2020). Furthermore, in the state of Rio de Janeiro, studies have shown that the frequency of parasitism by A. ovale in dogs tends to be low or even zero (Santos et al, 2013;Cordeiro et al, 2015;Campos et al, 2020).…”
Section: Variablementioning
confidence: 99%
“…The presence of rickettsial DNA was tested for by conventional PCR, targeting the citrate synthase (gltA) gene following the procedures of Regnery et al (1991), with modifications proposed by Campos et al (2020). Amplifications were carried out using 10 pmol of each primer (5′ TTGGGGRCCTGCTCACGG 3′ and 5′ ATTGCAAAAAGTACAGTGAACA 3′), 1.5 mM of magnesium chloride, 0.2 mM of dNTPs, 1 U of Taq DNA polymerase, and 100 ng of genomic DNA.…”
Section: Dna Extraction From Ticks and Molecular Analysismentioning
confidence: 99%
“…No obstante, R. akari, R. rickettsii y R. conorii ocasionan cuadros severos, tanto en infecciones naturales como en aquellas producidas experimentalmente bajo condiciones de laboratorio (Solano-Gallego et al 2006a;Zavala-Castro et al 2009;Levin et al 2014;Solano-Gallego et al 2015;Campos et al 2020).…”
Section: Signos Clínicos De La Rickettsiosis Caninaunclassified
“…Si la infección progresa a enfermedad severa, se desarrollan lesiones oculares, dolor en las articulaciones de las patas que generan cojeras y posturas anormales, y signos nerviosos como paraparesia (i.e., parálisis parcial de sistema nervioso central y periférico), tetraparesia (i.e., parálisis parcial o total de las cuatro patas) y ataxia vestibular que se traduce en trastornos en la forma de caminar y movimientos extraños en la cabeza (Solano-Gallego et al 2006a,b;López del P. et al 2007;Zavala-Castro et al 2009;Solano-Gallego et al 2015;Campos et al 2020).…”
Section: Signos Clínicos De La Rickettsiosis Caninaunclassified
“…Ela pode apresentar um curso clínico variável e a letalidade dos casos mais graves pode chegar a 80%, se não tratada de forma precoce (5). Em animais, essa doença é pouco explorada no Brasil, dispondo na literatura, majoritariamente, de dados soroepidemiológicos, contudo já foram observadas manifestações clínicas em cães, tanto por infecção experimental (6) como natural (7,8) e sintomatologia em um cavalo nos Estados Unidos (9). Cães, cavalos e, principalmente, capivaras são importantes reservatórios da cadeia epidemiológica da doença.…”
Section: Introductionunclassified