SPOCK1 is up-regulated and promotes tumor growth via the PI3K/AKT signaling pathway in colorectal cancer

Zhang, Jiaxuan; Zhi, Xiaofei; Shi, Shiyu; Tao, Ran; Chen, Peisheng; Sun, Shiyu; Bian, Longjun; Xu, Zixiang; Ma, Lan

doi:10.1016/j.bbrc.2016.11.126

Cited by 38 publications

(41 citation statements)

References 29 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Beyond all that, though, as previously reported, SPOCK1 could promote cell proliferation in colorectal cancer and prostatic cancer . However, in this study of ours, to exclude the possibility that the positive role of SPOCK1 in cell migration and invasion was as a result of different proliferation rates, our data showed that SPOCK1 almost did not affect the proliferation of gastric cancer cells in vitro and in vivo assays.…”

Section: Discussionsupporting

confidence: 58%

“…A negative sequence was employed as a control. The sequences of sh‐SPOCK1 and sh‐Slug were 5′‐GUAAUGAGGAGGGCUAUUA‐3′ and 5′‐GAGGAAAGACTACAGTCCAAGTT‐3′, respectively. The lentivirus with SPOCK1‐gene was produced by cotransfection of 293T cells with Lipofiter, and transfected into SGC7901 and SNU216 cells, while Slug gene transfection for AGS cells.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

SPOCK1 promotes the invasion and metastasis of gastric cancer through Slug‐induced epithelial‐mesenchymal transition

Chen

Zhou

Liu

et al. 2017

J Cellular Molecular Medi

View full text Add to dashboard Cite

Metastasis is a crucial impediment to the successful treatment for gastric cancer. SPOCK1 has been demonstrated to facilitate cancer metastasis in certain types of cancers; however, the role of SPOCK1 in the invasion and metastasis of gastric cancer remains elusive. SPOCK1 and epithelial‐mesenchymal transition (EMT)‐related biomarkers were detected by immunohistochemistry and Western blot in gastric cancer specimens. Other methods including stably transfected against SPOCK1 into gastric cancer cells, Western blot, migration and invasion assays in vitro and metastasis assay in vivo were also performed. The elevated expression of SPOCK1 correlates with EMT‐related markers in human gastric cancer tissue, clinical metastasis and a poor prognosis in patients with gastric cancer. In addition, knockdown of SPOCK1 expression significantly inhibits the invasion and metastasis of gastric cancer cells in vitro and in vivo, inversely, SPOCK1 overexpression results in the opposite effect. Interestingly, SPOCK1 expression has no effect on cell proliferation in vitro and in vivo. Regarding the mechanism(s) of SPOCK1‐induced cells invasion and metastasis, we prove that Slug‐induced EMT is involved in SPOCK1‐facilitating gastric cancer cells invasion and metastasis. The elevated SPOCK1 expression is closely correlated with cancer metastasis and patient survival, and SPOCK1 promotes the invasion and metastasis of gastric cancer through Slug‐mediated EMT, thereby possibly providing a novel therapeutic target for gastric cancer.

show abstract

Section: Discussionsupporting

confidence: 58%

Section: Methodsmentioning

confidence: 99%

SPOCK1 promotes the invasion and metastasis of gastric cancer through Slug‐induced epithelial‐mesenchymal transition

Chen

Zhou

Liu

et al. 2017

J Cellular Molecular Medi

View full text Add to dashboard Cite

show abstract

“…Previous studies reported that SPOCK1 could mediate EMT by Wnt/β-catenin signaling in non-small cell lung cancer (8), PI3K/AKT signaling pathway in colorectal cancer and others (7). Moreover, SPOCK1 blocked gallbladder cancer (GBC) cell apoptosis and promoted cell proliferation and metastasis via activating PI3K/Akt signaling both in vitro and in vivo (44).…”

Section: Discussionmentioning

confidence: 99%

“…Unquestionably, EMT is identified as the dominant program in BC initiation and metastatic spread (38,39). A previous study revealed that deregulating the expression of SPOCK1 suppressed colorectal cancer (CRC) proliferation in vitro and vivo, SPOCK1 was involved in CRC malignant features (7). Notably, SPOCK1 was altered by EPCR to mediate 3D growth consequently promoted breast cancer progression (40).…”

Section: Discussionmentioning

confidence: 99%

SPOCK1 promotes breast cancer progression via interacting with SIX1 and activating AKT/mTOR signaling pathway

Zhang

et al. 2019

Preprint

View full text Add to dashboard Cite

SPOCK1 is highly expressed in many types of cancer, which has been recognized as a promoter of cancer progression, while its regulatory mechanism remains to be clear in breast cancer (BC). This study aimed to explore the precise function of SPOCK1 in BC progression and the mechanism by which SPOCK1 was involved in cell proliferation and epithelial-mesenchymal transition (EMT).Immunohistochemistry (IHC) and database analysis displayed that high expression of SPOCK1 was positively associated with histological grade, lymph node metastasis (LN) and poor clinical prognosis in BC. A series of assays both in vitro and in vivo elucidated that altering SPOCK1 level led to distinctly changes in BC cell proliferation and metastasis. Investigations of potential mechanisms revealed that SPOCK1 interacted with SIX1 could enhance cell proliferation, cell cycle and EMT process by activating the AKT/mTOR pathway, whereas inhibition of AKT/mTOR pathway or depletion of SIX1 reversed the effects of SPOCK1 overexpression.Furthermore, SPOCK1 and SIX1 were highly expressed in BC and might indicate poor prognoses. Altogether, SPOCK1/SIX1 promoted BC progression by activating AKT/mTOR pathway to accelerate cell proliferation and metastasis in BC, and SPOCK1/SIX1 might be promising clinical therapeutic targets to prevent BC progression. IMPORTANCE:The incidence of BC is alarmingly high and many patients initially diagnosed without detectable metastases will eventually develop metastatic lesions. The occurrence of metastasis is responsible for the death of many patients, which also represents a big challenge for researchers to improve the survival rates of BC patients.Hence the scientific community pays more attention on cancer targeted therapy. This research is significant for identifying the underlying mechanisms and capabilities of SPOCK1-induced BC activities, which will greatly apply novel targets and new treatment strategies for clinicians, leading to broader biomedical impacts. KEYWORDS: SPOCK1; SIX1; EMT; Breast cancer; AKT/mTOR signaling pathwayBreast cancer (BC), the most frequently diagnosed lethal gynecologic malignancy in women worldwide (1), which is an increasing concern because of its rising incidence. Despite major advances in BC therapy, the prognosis for most patients would be significantly worse once spread metastasized occurs (2). Metastasis is the mainspring for most patient death and represents the fundamental challenge of the clinical treatment for the patients with BC. The initiation and metastasis of BC are intricate processes, which triggered by multiple genes and intracellular signal transduction cross-talks. Thus, looking for valid molecular hallmarks and understanding the mechanisms of BC initiation and metastasis process are urged to put on the agenda. Sparc/osteonectin, cwcv and kazal-like domains proteoglycan 1 (SPOCK1), is also known as TIC1; SPOCK; TESTICAN, belongs to multidomain testicular proteoglycan family (3). This protein family includes SPARC, TESTICAN-2, and TESTICAN-3, which are associated with ...

show abstract

“…Activation of membrane kinases including epidermal growth factor receptor (EGFR) by external growth factors initiates receptor dimerization and subsequent events to activate these intraCell ular pathways. AKT is activated downstream of PI3K and has multiple targets [34]. PTP-1B acts as a negative regulator of insulin signaling by dephosphorylating the phosphotyrosine residues of insulin receptor kinase.…”

Section: Hypoglycemic Mechanismsmentioning

confidence: 99%

Phytochemicals for Non-insulin Diabetes Mellitus: A Minireview on Plant-Derived Compounds Hypoglycemic Activity

Chen¹

2017

JFNS

View full text Add to dashboard Cite

Diabetes mellitus (DM), a group of chronic metabolic disorders characterized by hyperglycemia resulting from defects in insulin action and/or insulin secretion. It represents one of the main contributors to ill health and premature mortality worldwide and its prevalence has been rising during the last decades. Unfortunately, many antidiabetic agents for diabetes either have inadequate efficacy or significant mechanism-based side effects. A great deal of interest has been developed to the various natural bioactive compounds isolated and characterized from medicinal plants. This review focuses specifically on four nature phytochemicals such as polysaccharides, flavonoids, saponins and alkaloids whose properties are potencial to antidiabetic remedy.

show abstract

SPOCK1 is up-regulated and promotes tumor growth via the PI3K/AKT signaling pathway in colorectal cancer

Cited by 38 publications

References 29 publications

SPOCK1 promotes the invasion and metastasis of gastric cancer through Slug‐induced epithelial‐mesenchymal transition

SPOCK1 promotes the invasion and metastasis of gastric cancer through Slug‐induced epithelial‐mesenchymal transition

SPOCK1 promotes breast cancer progression via interacting with SIX1 and activating AKT/mTOR signaling pathway

Phytochemicals for Non-insulin Diabetes Mellitus: A Minireview on Plant-Derived Compounds Hypoglycemic Activity

Contact Info

Product

Resources

About